diff options
Diffstat (limited to 'python-eltetrado.spec')
| -rw-r--r-- | python-eltetrado.spec | 5896 |
1 files changed, 5896 insertions, 0 deletions
diff --git a/python-eltetrado.spec b/python-eltetrado.spec new file mode 100644 index 0000000..25ac544 --- /dev/null +++ b/python-eltetrado.spec @@ -0,0 +1,5896 @@ +%global _empty_manifest_terminate_build 0 +Name: python-eltetrado +Version: 1.5.15 +Release: 1 +Summary: Find and classify tetrads and quadruplexes in DNA/RNA 3D structure +License: MIT License +URL: https://github.com/tzok/eltetrado +Source0: https://mirrors.nju.edu.cn/pypi/web/packages/63/a5/eade5c2ccfa45c110468f91e98191b35be42e29ae1c243db07e35d3717ce/eltetrado-1.5.15.tar.gz +BuildArch: noarch + +Requires: python3-mmcif +Requires: python3-numpy +Requires: python3-orjson +Requires: python3-rnapolis + +%description + + +# Project description + +This is an application to analyze base pairing patterns of DNA/RNA 3D +structures to find and classify tetrads and quadruplexes. ElTetrado +assigns tetrads to one of the ONZ classes (O, N, Z) alongside with the +directionality of the tetrad (+/-) determined by the bonds between bases +and their non-canonical interactions. The interactions follow +Leontis/Westhof classification (Leontis *et al.* 2001). Watson-Crick (W) +edge of first base in the tetrad structure exposed to the Hoogsteen (H) +edge of the next nucleobase from the same tetrad sets the tetrad +directionality, clockwise (+) or anticlockwise (-). For more details, +please refer to Zok *et al.* (2020) and Popenda *et al.* (2020) + +# Installation + +Please run: + + pip install eltetrado + +If you have both Python 2 and Python 3 installed, you need to explicitly +call `pip3`: + + pip3 install eltetrado + +# Dependencies + +The project is written in Python 3.6+ and requires +[mmcif](https://pypi.org/project/mmcif/), +[orjson](https://github.com/ijl/orjson), [NumPy](https://numpy.org/) and +[requests](https://docs.python-requests.org/en/latest/). + +Visualization is created by `R` 3.6+ script which uses +[R4RNA](https://www.e-rna.org/r-chie/) (Lai *et al.* 2012) library. The +dependency will be automatically installed if not present. + +Base pairs and stacking interactions are identified by +[RNApolis](https://github.com/tzok/rnapolis-py). + +# Usage + +ElTetrado is a command line application, which requires to be provided +with `--input` and a path to a PDB or PDBx/mmCIF file. + +By default, ElTetrado outputs textual results on the standard output. A +JSON version of the output can be obtained with `--output` switch +followed by a path where the file is supposed to be created. + +ElTetrado prepares visualization of the whole structure and of each +N4-helices, quadruplexes and tetrads. This can be supplemented with +canonical base pairs visualization when `--complete-2d` is set. All +color settings are located in the first several lines of the `quadraw.R` +file, you can easily change them without knowledge of R language. If you +want ElTetrado to not visualize anything, pass `--no-image` switch to +it. + + usage: eltetrado [-h] [-i INPUT] [-o OUTPUT] [-m MODEL] + [--stacking-mismatch STACKING_MISMATCH] [--strict] + [--no-reorder] [--complete-2d] [--no-image] + [--dssr-json DSSR_JSON] [-v] + + options: + -h, --help show this help message and exit + -i INPUT, --input INPUT + path to input PDB or PDBx/mmCIF file + -o OUTPUT, --output OUTPUT + (optional) path for output JSON file + -m MODEL, --model MODEL + (optional) model number to process + --stacking-mismatch STACKING_MISMATCH + a perfect tetrad stacking covers 4 nucleotides; this + option can be used with value 1 or 2 to allow this + number of nucleotides to be non-stacked with otherwise + well aligned tetrad [default=2] + --strict nucleotides in tetrad are found when linked only by + cWH pairing + --no-reorder chains of bi- and tetramolecular quadruplexes should + be reordered to be able to have them classified; when + this is set, chains will be processed in original + order, which for bi-/tetramolecular means that they + will likely be misclassified; use with care! + --complete-2d when set, the visualization will also show canonical + base pairs to provide context for the quadruplex + --no-image when set, the visualization will not be created at all + --dssr-json DSSR_JSON + (optional) provide a JSON file generated by DSSR to + read the secondary structure information from (use + --nmr and --json switches) + -v, --version show program's version number and exit + +# Chains reorder + +ElTetrado keeps a global and unique 5’-3’ index for every nucleotide +which is independent from residue numbers. For example, if a structure +has chain M with 60 nucleotides and chain N with 15 nucleotides, then +ElTetrado will keep index between 0 and 74 which uniquely identifies +every nucleotide. Initially, ElTetrado assigns this indices according to +the order of chains in the input file. Therefore, if M preceded N then +nucleotides in M will be indexed from 0 to 59 and in N from 60 to 74. +Otherwise, nucleotides in N will be indexed from 0 to 14 and in M from +15 to 74. + +When `--no-reorder` is present, this initial assignment is used. +Otherwise, ElTetrado exhaustively checks all permutations of chains’ +orders. Every permutation check induces recalculation of the global and +unique 5’-3’ index and in effect it changes ONZ classification of +tetrads. + +ElTetrado keeps a table of tetrad classification scores according to +these rules: + +- Type preference: `O` \> `N` \> `Z` +- Direction preference: `+` \> `-` + +The table keeps low values for preferred classes i.e. `O+` is 0, `O-` is +1 and so on up to `Z-` with score 5. For every permutation of chain +orders, ElTetrado computes sum of scores for tetrads classification +induced by 5’-3’ indexing. We select permutation with the minimum value. + +# Examples + +## 2HY9: Human telomere DNA quadruplex structure in K+ solution hybrid-1 form + + + + $ curl ftp://ftp.wwpdb.org/pub/pdb/data/structures/divided/mmCIF/my/2hy9.cif.gz | gzip -d > 2hy9.cif + $ ./eltetrado --input 2hy9.cif --output 2hy9.json + + Chain order: 1 + n4-helix with 3 tetrads + Oh* V,VI 9a -(pll) quadruplex with 3 tetrads + 1.DG4 1.DG22 1.DG18 1.DG10 cWH cWH cWH cWH O- Vb planarity=0.17 + direction=hybrid rise=3.21 twist=16.23 + 1.DG5 1.DG23 1.DG17 1.DG11 cHW cHW cHW cHW O+ Va planarity=0.1 + direction=hybrid rise=3.11 twist=27.45 + 1.DG6 1.DG24 1.DG16 1.DG12 cHW cHW cHW cHW O+ VIa planarity=0.18 + + Tracts: + 1.DG4, 1.DG5, 1.DG6 + 1.DG22, 1.DG23, 1.DG24 + 1.DG18, 1.DG17, 1.DG16 + 1.DG10, 1.DG11, 1.DG12 + + Loops: + propeller- 1.DT7, 1.DT8, 1.DA9 + lateral- 1.DT13, 1.DT14, 1.DA15 + lateral+ 1.DT19, 1.DT20, 1.DA21 + + AAAGGGTTAGGGTTAGGGTTAGGGAA + ...([{...(((...)))...)]}.. + ...([{...)]}...(((...))).. + +<details> +<summary> +Click to see the output JSON +</summary> + +``` json +{ + "metals": [], + "nucleotides": [ + { + "index": 1, + "chain": "1", + "number": 1, + "icode": null, + "molecule": "DNA", + "fullName": "1.DA1", + "shortName": "A", + "chi": 22.308282830857802, + "glycosidicBond": "syn" + }, + { + "index": 2, + "chain": "1", + "number": 2, + "icode": null, + "molecule": "DNA", + "fullName": "1.DA2", + "shortName": "A", + "chi": -123.05454402191421, + "glycosidicBond": "anti" + }, + { + "index": 3, + "chain": "1", + "number": 3, + "icode": null, + "molecule": "DNA", + "fullName": "1.DA3", + "shortName": "A", + "chi": -94.96579955603106, + "glycosidicBond": "anti" + }, + { + "index": 4, + "chain": "1", + "number": 4, + "icode": null, + "molecule": "DNA", + "fullName": "1.DG4", + "shortName": "G", + "chi": 79.28363721639316, + "glycosidicBond": "syn" + }, + { + "index": 5, + "chain": "1", + "number": 5, + "icode": null, + "molecule": "DNA", + "fullName": "1.DG5", + "shortName": "G", + "chi": -126.01709201555563, + "glycosidicBond": "anti" + }, + { + "index": 6, + "chain": "1", + "number": 6, + "icode": null, + "molecule": "DNA", + "fullName": "1.DG6", + "shortName": "G", + "chi": -127.26656202302102, + "glycosidicBond": "anti" + }, + { + "index": 7, + "chain": "1", + "number": 7, + "icode": null, + "molecule": "DNA", + "fullName": "1.DT7", + "shortName": "T", + "chi": -63.10830751967371, + "glycosidicBond": "syn" + }, + { + "index": 8, + "chain": "1", + "number": 8, + "icode": null, + "molecule": "DNA", + "fullName": "1.DT8", + "shortName": "T", + "chi": -138.79520345559828, + "glycosidicBond": "anti" + }, + { + "index": 9, + "chain": "1", + "number": 9, + "icode": null, + "molecule": "DNA", + "fullName": "1.DA9", + "shortName": "A", + "chi": -148.83990757408878, + "glycosidicBond": "anti" + }, + { + "index": 10, + "chain": "1", + "number": 10, + "icode": null, + "molecule": "DNA", + "fullName": "1.DG10", + "shortName": "G", + "chi": 58.7787525019158, + "glycosidicBond": "syn" + }, + { + "index": 11, + "chain": "1", + "number": 11, + "icode": null, + "molecule": "DNA", + "fullName": "1.DG11", + "shortName": "G", + "chi": -123.85746807924986, + "glycosidicBond": "anti" + }, + { + "index": 12, + "chain": "1", + "number": 12, + "icode": null, + "molecule": "DNA", + "fullName": "1.DG12", + "shortName": "G", + "chi": -84.36679807284759, + "glycosidicBond": "syn" + }, + { + "index": 13, + "chain": "1", + "number": 13, + "icode": null, + "molecule": "DNA", + "fullName": "1.DT13", + "shortName": "T", + "chi": -30.819029132834157, + "glycosidicBond": "syn" + }, + { + "index": 14, + "chain": "1", + "number": 14, + "icode": null, + "molecule": "DNA", + "fullName": "1.DT14", + "shortName": "T", + "chi": -168.51776782812965, + "glycosidicBond": "anti" + }, + { + "index": 15, + "chain": "1", + "number": 15, + "icode": null, + "molecule": "DNA", + "fullName": "1.DA15", + "shortName": "A", + "chi": -105.72881577106517, + "glycosidicBond": "anti" + }, + { + "index": 16, + "chain": "1", + "number": 16, + "icode": null, + "molecule": "DNA", + "fullName": "1.DG16", + "shortName": "G", + "chi": 74.3227942181243, + "glycosidicBond": "syn" + }, + { + "index": 17, + "chain": "1", + "number": 17, + "icode": null, + "molecule": "DNA", + "fullName": "1.DG17", + "shortName": "G", + "chi": 81.08424926936044, + "glycosidicBond": "syn" + }, + { + "index": 18, + "chain": "1", + "number": 18, + "icode": null, + "molecule": "DNA", + "fullName": "1.DG18", + "shortName": "G", + "chi": -122.90397217111551, + "glycosidicBond": "anti" + }, + { + "index": 19, + "chain": "1", + "number": 19, + "icode": null, + "molecule": "DNA", + "fullName": "1.DT19", + "shortName": "T", + "chi": -102.98239337113938, + "glycosidicBond": "anti" + }, + { + "index": 20, + "chain": "1", + "number": 20, + "icode": null, + "molecule": "DNA", + "fullName": "1.DT20", + "shortName": "T", + "chi": -112.1514601849715, + "glycosidicBond": "anti" + }, + { + "index": 21, + "chain": "1", + "number": 21, + "icode": null, + "molecule": "DNA", + "fullName": "1.DA21", + "shortName": "A", + "chi": -89.07113063649612, + "glycosidicBond": "syn" + }, + { + "index": 22, + "chain": "1", + "number": 22, + "icode": null, + "molecule": "DNA", + "fullName": "1.DG22", + "shortName": "G", + "chi": 83.44318693001902, + "glycosidicBond": "syn" + }, + { + "index": 23, + "chain": "1", + "number": 23, + "icode": null, + "molecule": "DNA", + "fullName": "1.DG23", + "shortName": "G", + "chi": -115.41210237198398, + "glycosidicBond": "anti" + }, + { + "index": 24, + "chain": "1", + "number": 24, + "icode": null, + "molecule": "DNA", + "fullName": "1.DG24", + "shortName": "G", + "chi": -111.14845782593531, + "glycosidicBond": "anti" + }, + { + "index": 25, + "chain": "1", + "number": 25, + "icode": null, + "molecule": "DNA", + "fullName": "1.DA25", + "shortName": "A", + "chi": -58.323530637551954, + "glycosidicBond": "syn" + }, + { + "index": 26, + "chain": "1", + "number": 26, + "icode": null, + "molecule": "DNA", + "fullName": "1.DA26", + "shortName": "A", + "chi": -90.84065243137135, + "glycosidicBond": "anti" + } + ], + "basePairs": [ + { + "nt1": "1.DA3", + "nt2": "1.DA21", + "lw": "cHW", + "inTetrad": false, + "canonical": false + }, + { + "nt1": "1.DG4", + "nt2": "1.DG10", + "lw": "cHW", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "1.DG4", + "nt2": "1.DG22", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "1.DG5", + "nt2": "1.DG11", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "1.DG5", + "nt2": "1.DG23", + "lw": "cHW", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "1.DG6", + "nt2": "1.DG12", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "1.DG6", + "nt2": "1.DG24", + "lw": "cHW", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "1.DG10", + "nt2": "1.DG18", + "lw": "cHW", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "1.DG11", + "nt2": "1.DG17", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "1.DG12", + "nt2": "1.DG16", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "1.DT14", + "nt2": "1.DA25", + "lw": "tWW", + "inTetrad": false, + "canonical": false + }, + { + "nt1": "1.DG16", + "nt2": "1.DG24", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "1.DG17", + "nt2": "1.DG23", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "1.DG18", + "nt2": "1.DG22", + "lw": "cHW", + "inTetrad": true, + "canonical": false + } + ], + "helices": [ + { + "quadruplexes": [ + { + "tetrads": [ + { + "id": "1.DG4-1.DG22-1.DG18-1.DG10", + "nt1": "1.DG4", + "nt2": "1.DG22", + "nt3": "1.DG18", + "nt4": "1.DG10", + "onz": "O-", + "gbaClassification": "Vb", + "planarityDeviation": 0.17372283960377805, + "ionsChannel": [], + "ionsOutside": [] + }, + { + "id": "1.DG5-1.DG23-1.DG17-1.DG11", + "nt1": "1.DG5", + "nt2": "1.DG23", + "nt3": "1.DG17", + "nt4": "1.DG11", + "onz": "O+", + "gbaClassification": "Va", + "planarityDeviation": 0.10474313820007483, + "ionsChannel": [], + "ionsOutside": [] + }, + { + "id": "1.DG6-1.DG24-1.DG16-1.DG12", + "nt1": "1.DG6", + "nt2": "1.DG24", + "nt3": "1.DG16", + "nt4": "1.DG12", + "onz": "O+", + "gbaClassification": "VIa", + "planarityDeviation": 0.18293509778060615, + "ionsChannel": [], + "ionsOutside": [] + } + ], + "onzm": "Oh*", + "loopClassification": { + "classification": "9a", + "loopProgression": "-(pll)" + }, + "gbaClassification": [ + "V", + "VI" + ], + "tracts": [ + [ + "1.DG4", + "1.DG5", + "1.DG6" + ], + [ + "1.DG22", + "1.DG23", + "1.DG24" + ], + [ + "1.DG18", + "1.DG17", + "1.DG16" + ], + [ + "1.DG10", + "1.DG11", + "1.DG12" + ] + ], + "loops": [ + { + "type": "propeller-", + "nucleotides": [ + "1.DT7", + "1.DT8", + "1.DA9" + ] + }, + { + "type": "lateral-", + "nucleotides": [ + "1.DT13", + "1.DT14", + "1.DA15" + ] + }, + { + "type": "lateral+", + "nucleotides": [ + "1.DT19", + "1.DT20", + "1.DA21" + ] + } + ] + } + ], + "tetradPairs": [ + { + "tetrad1": "1.DG4-1.DG22-1.DG18-1.DG10", + "tetrad2": "1.DG5-1.DG23-1.DG17-1.DG11", + "direction": "hybrid", + "rise": 3.2109650905140654, + "twist": 16.228973729066034 + }, + { + "tetrad1": "1.DG5-1.DG23-1.DG17-1.DG11", + "tetrad2": "1.DG6-1.DG24-1.DG16-1.DG12", + "direction": "hybrid", + "rise": 3.1149939255558747, + "twist": 27.448958336697046 + } + ] + } + ], + "dotBracket": { + "sequence": "AAAGGGTTAGGGTTAGGGTTAGGGAA", + "line1": "...([{...(((...)))...)]}..", + "line2": "...([{...)]}...(((...))).." + } +} +``` + +</details> + +## 4RJ1: Structural variations and solvent structure of UGGGGU quadruplexes stabilized by Sr2+ ions + + + + $ curl https://www.ebi.ac.uk/pdbe/static/entry/download/4rj1-assembly-1.cif.gz | gzip -d > 4rj1-1.cif + $ ./eltetrado --input 4rj1-1.cif --output 4rj1-1.json + + Chain order: A AB AA AC B BC BA BB + n4-helix with 10 tetrads + Op* VIII n/a quadruplex with 5 tetrads + A.U1006 AC.U1006 AA.U1006 AB.U1006 cWH cWH cWH cWH O- VIIIa planarity=1.06 ions_channel=NA ions_outside=A.U1006: [SR] AA.U1006: [SR] AB.U1006: [SR] AC.U1006: [SR] + direction=parallel rise=3.37 twist=39.96 + A.G1005 AC.G1005 AA.G1005 AB.G1005 cHW cHW cHW cHW O+ VIIIa planarity=0.8 + direction=parallel rise=3.31 twist=25.9 + A.G1004 AC.G1004 AA.G1004 AB.G1004 cHW cHW cHW cHW O+ VIIIa planarity=0.41 ions_channel=SR + direction=parallel rise=3.34 twist=35.81 + A.G1003 AC.G1003 AA.G1003 AB.G1003 cHW cHW cHW cHW O+ VIIIa planarity=0.55 ions_channel=SR + direction=parallel rise=3.29 twist=27.12 + A.G1002 AC.G1002 AA.G1002 AB.G1002 cHW cHW cHW cHW O+ VIIIa planarity=0.54 ions_outside=AB.G1002: [CA] AC.G1002: [CA] AA.G1002: [CA] A.G1002: [CA] + + Tracts: + A.U1006, A.G1005, A.G1004, A.G1003, A.G1002 + AC.U1006, AC.G1005, AC.G1004, AC.G1003, AC.G1002 + AA.U1006, AA.G1005, AA.G1004, AA.G1003, AA.G1002 + AB.U1006, AB.G1005, AB.G1004, AB.G1003, AB.G1002 + + Op* VIII n/a quadruplex with 5 tetrads + B.G2002 BC.G2002 BA.G2002 BB.G2002 cWH cWH cWH cWH O+ VIIIa planarity=0.67 + direction=parallel rise=3.37 twist=27.41 + B.G2003 BC.G2003 BA.G2003 BB.G2003 cWH cWH cWH cWH O+ VIIIa planarity=0.58 ions_channel=SR ions_outside=B.G2003: [CA] BA.G2003: [CA] BB.G2003: [CA] BC.G2003: [CA] + direction=parallel rise=3.32 twist=35.04 + B.G2004 BC.G2004 BA.G2004 BB.G2004 cWH cWH cWH cWH O+ VIIIa planarity=0.23 ions_channel=SR + direction=parallel rise=3.27 twist=25.15 + B.G2005 BC.G2005 BA.G2005 BB.G2005 cWH cWH cWH cWH O+ VIIIa planarity=0.78 ions_channel=NA + direction=parallel rise=7.14 twist=43.41 + B.U2006 BC.U2006 BA.U2006 BB.U2006 cHW cHW cHW cHW O- VIIIa planarity=1.58 ions_channel=NA,NA + + Tracts: + B.G2002, B.G2003, B.G2004, B.G2005, B.U2006 + BC.G2002, BC.G2003, BC.G2004, BC.G2005, BC.U2006 + BA.G2002, BA.G2003, BA.G2004, BA.G2005, BA.U2006 + BB.G2002, BB.G2003, BB.G2004, BB.G2005, BB.U2006 + + UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU + .([{<A-.([{<A-.)]}>a-.)]}>a-.([{<A-.)]}>a-.([{<A-.)]}>a + .([{<A-.)]}>a-.([{<A-.)]}>a-.([{<A-.([{<A-.)]}>a-.)]}>a + +<details> +<summary> +Click to see the output JSON +</summary> + +``` json +{ + "metals": [ + { + "symbol": "Sr", + "count": 8 + }, + { + "symbol": "Na", + "count": 4 + }, + { + "symbol": "Ca", + "count": 12 + } + ], + "nucleotides": [ + { + "index": 1, + "chain": "A", + "number": 1001, + "icode": null, + "molecule": "RNA", + "fullName": "A.U1001", + "shortName": "U", + "chi": -141.92671313255752, + "glycosidicBond": "anti" + }, + { + "index": 2, + "chain": "A", + "number": 1002, + "icode": null, + "molecule": "RNA", + "fullName": "A.G1002", + "shortName": "G", + "chi": -165.93034671112116, + "glycosidicBond": "anti" + }, + { + "index": 3, + "chain": "A", + "number": 1003, + "icode": null, + "molecule": "RNA", + "fullName": "A.G1003", + "shortName": "G", + "chi": -121.5652426033226, + "glycosidicBond": "anti" + }, + { + "index": 4, + "chain": "A", + "number": 1004, + "icode": null, + "molecule": "RNA", + "fullName": "A.G1004", + "shortName": "G", + "chi": -156.00957673923344, + "glycosidicBond": "anti" + }, + { + "index": 5, + "chain": "A", + "number": 1005, + "icode": null, + "molecule": "RNA", + "fullName": "A.G1005", + "shortName": "G", + "chi": -148.10051684016415, + "glycosidicBond": "anti" + }, + { + "index": 6, + "chain": "A", + "number": 1006, + "icode": null, + "molecule": "RNA", + "fullName": "A.U1006", + "shortName": "U", + "chi": -137.28005568139983, + "glycosidicBond": "anti" + }, + { + "index": 13, + "chain": "AA", + "number": 1001, + "icode": null, + "molecule": "RNA", + "fullName": "AA.U1001", + "shortName": "U", + "chi": -141.9267131325575, + "glycosidicBond": "anti" + }, + { + "index": 14, + "chain": "AA", + "number": 1002, + "icode": null, + "molecule": "RNA", + "fullName": "AA.G1002", + "shortName": "G", + "chi": -165.93034671112113, + "glycosidicBond": "anti" + }, + { + "index": 15, + "chain": "AA", + "number": 1003, + "icode": null, + "molecule": "RNA", + "fullName": "AA.G1003", + "shortName": "G", + "chi": -121.56524260332266, + "glycosidicBond": "anti" + }, + { + "index": 16, + "chain": "AA", + "number": 1004, + "icode": null, + "molecule": "RNA", + "fullName": "AA.G1004", + "shortName": "G", + "chi": -156.0095767392335, + "glycosidicBond": "anti" + }, + { + "index": 17, + "chain": "AA", + "number": 1005, + "icode": null, + "molecule": "RNA", + "fullName": "AA.G1005", + "shortName": "G", + "chi": -148.10051684016406, + "glycosidicBond": "anti" + }, + { + "index": 18, + "chain": "AA", + "number": 1006, + "icode": null, + "molecule": "RNA", + "fullName": "AA.U1006", + "shortName": "U", + "chi": -137.2800556813998, + "glycosidicBond": "anti" + }, + { + "index": 7, + "chain": "AB", + "number": 1001, + "icode": null, + "molecule": "RNA", + "fullName": "AB.U1001", + "shortName": "U", + "chi": -141.9267131325574, + "glycosidicBond": "anti" + }, + { + "index": 8, + "chain": "AB", + "number": 1002, + "icode": null, + "molecule": "RNA", + "fullName": "AB.G1002", + "shortName": "G", + "chi": -165.93034671112113, + "glycosidicBond": "anti" + }, + { + "index": 9, + "chain": "AB", + "number": 1003, + "icode": null, + "molecule": "RNA", + "fullName": "AB.G1003", + "shortName": "G", + "chi": -121.56524260332266, + "glycosidicBond": "anti" + }, + { + "index": 10, + "chain": "AB", + "number": 1004, + "icode": null, + "molecule": "RNA", + "fullName": "AB.G1004", + "shortName": "G", + "chi": -156.00957673923347, + "glycosidicBond": "anti" + }, + { + "index": 11, + "chain": "AB", + "number": 1005, + "icode": null, + "molecule": "RNA", + "fullName": "AB.G1005", + "shortName": "G", + "chi": -148.10051684016406, + "glycosidicBond": "anti" + }, + { + "index": 12, + "chain": "AB", + "number": 1006, + "icode": null, + "molecule": "RNA", + "fullName": "AB.U1006", + "shortName": "U", + "chi": -137.28005568139977, + "glycosidicBond": "anti" + }, + { + "index": 19, + "chain": "AC", + "number": 1001, + "icode": null, + "molecule": "RNA", + "fullName": "AC.U1001", + "shortName": "U", + "chi": -141.92671313255747, + "glycosidicBond": "anti" + }, + { + "index": 20, + "chain": "AC", + "number": 1002, + "icode": null, + "molecule": "RNA", + "fullName": "AC.G1002", + "shortName": "G", + "chi": -165.93034671112116, + "glycosidicBond": "anti" + }, + { + "index": 21, + "chain": "AC", + "number": 1003, + "icode": null, + "molecule": "RNA", + "fullName": "AC.G1003", + "shortName": "G", + "chi": -121.56524260332266, + "glycosidicBond": "anti" + }, + { + "index": 22, + "chain": "AC", + "number": 1004, + "icode": null, + "molecule": "RNA", + "fullName": "AC.G1004", + "shortName": "G", + "chi": -156.00957673923352, + "glycosidicBond": "anti" + }, + { + "index": 23, + "chain": "AC", + "number": 1005, + "icode": null, + "molecule": "RNA", + "fullName": "AC.G1005", + "shortName": "G", + "chi": -148.1005168401641, + "glycosidicBond": "anti" + }, + { + "index": 24, + "chain": "AC", + "number": 1006, + "icode": null, + "molecule": "RNA", + "fullName": "AC.U1006", + "shortName": "U", + "chi": -137.28005568139986, + "glycosidicBond": "anti" + }, + { + "index": 25, + "chain": "B", + "number": 2001, + "icode": null, + "molecule": "RNA", + "fullName": "B.U2001", + "shortName": "U", + "chi": -146.4615316869476, + "glycosidicBond": "anti" + }, + { + "index": 26, + "chain": "B", + "number": 2002, + "icode": null, + "molecule": "RNA", + "fullName": "B.G2002", + "shortName": "G", + "chi": -170.79660912745996, + "glycosidicBond": "anti" + }, + { + "index": 27, + "chain": "B", + "number": 2003, + "icode": null, + "molecule": "RNA", + "fullName": "B.G2003", + "shortName": "G", + "chi": -117.68718110874113, + "glycosidicBond": "anti" + }, + { + "index": 28, + "chain": "B", + "number": 2004, + "icode": null, + "molecule": "RNA", + "fullName": "B.G2004", + "shortName": "G", + "chi": -153.88587375071324, + "glycosidicBond": "anti" + }, + { + "index": 29, + "chain": "B", + "number": 2005, + "icode": null, + "molecule": "RNA", + "fullName": "B.G2005", + "shortName": "G", + "chi": -148.8519912845669, + "glycosidicBond": "anti" + }, + { + "index": 30, + "chain": "B", + "number": 2006, + "icode": null, + "molecule": "RNA", + "fullName": "B.U2006", + "shortName": "U", + "chi": -159.43730655241544, + "glycosidicBond": "anti" + }, + { + "index": 37, + "chain": "BA", + "number": 2001, + "icode": null, + "molecule": "RNA", + "fullName": "BA.U2001", + "shortName": "U", + "chi": -146.46153168694764, + "glycosidicBond": "anti" + }, + { + "index": 38, + "chain": "BA", + "number": 2002, + "icode": null, + "molecule": "RNA", + "fullName": "BA.G2002", + "shortName": "G", + "chi": -170.79660912745993, + "glycosidicBond": "anti" + }, + { + "index": 39, + "chain": "BA", + "number": 2003, + "icode": null, + "molecule": "RNA", + "fullName": "BA.G2003", + "shortName": "G", + "chi": -117.68718110874113, + "glycosidicBond": "anti" + }, + { + "index": 40, + "chain": "BA", + "number": 2004, + "icode": null, + "molecule": "RNA", + "fullName": "BA.G2004", + "shortName": "G", + "chi": -153.88587375071322, + "glycosidicBond": "anti" + }, + { + "index": 41, + "chain": "BA", + "number": 2005, + "icode": null, + "molecule": "RNA", + "fullName": "BA.G2005", + "shortName": "G", + "chi": -148.851991284567, + "glycosidicBond": "anti" + }, + { + "index": 42, + "chain": "BA", + "number": 2006, + "icode": null, + "molecule": "RNA", + "fullName": "BA.U2006", + "shortName": "U", + "chi": -159.43730655241544, + "glycosidicBond": "anti" + }, + { + "index": 43, + "chain": "BB", + "number": 2001, + "icode": null, + "molecule": "RNA", + "fullName": "BB.U2001", + "shortName": "U", + "chi": -146.4615316869476, + "glycosidicBond": "anti" + }, + { + "index": 44, + "chain": "BB", + "number": 2002, + "icode": null, + "molecule": "RNA", + "fullName": "BB.G2002", + "shortName": "G", + "chi": -170.79660912745993, + "glycosidicBond": "anti" + }, + { + "index": 45, + "chain": "BB", + "number": 2003, + "icode": null, + "molecule": "RNA", + "fullName": "BB.G2003", + "shortName": "G", + "chi": -117.68718110874106, + "glycosidicBond": "anti" + }, + { + "index": 46, + "chain": "BB", + "number": 2004, + "icode": null, + "molecule": "RNA", + "fullName": "BB.G2004", + "shortName": "G", + "chi": -153.8858737507132, + "glycosidicBond": "anti" + }, + { + "index": 47, + "chain": "BB", + "number": 2005, + "icode": null, + "molecule": "RNA", + "fullName": "BB.G2005", + "shortName": "G", + "chi": -148.85199128456696, + "glycosidicBond": "anti" + }, + { + "index": 48, + "chain": "BB", + "number": 2006, + "icode": null, + "molecule": "RNA", + "fullName": "BB.U2006", + "shortName": "U", + "chi": -159.43730655241544, + "glycosidicBond": "anti" + }, + { + "index": 31, + "chain": "BC", + "number": 2001, + "icode": null, + "molecule": "RNA", + "fullName": "BC.U2001", + "shortName": "U", + "chi": -146.4615316869476, + "glycosidicBond": "anti" + }, + { + "index": 32, + "chain": "BC", + "number": 2002, + "icode": null, + "molecule": "RNA", + "fullName": "BC.G2002", + "shortName": "G", + "chi": -170.79660912745993, + "glycosidicBond": "anti" + }, + { + "index": 33, + "chain": "BC", + "number": 2003, + "icode": null, + "molecule": "RNA", + "fullName": "BC.G2003", + "shortName": "G", + "chi": -117.68718110874121, + "glycosidicBond": "anti" + }, + { + "index": 34, + "chain": "BC", + "number": 2004, + "icode": null, + "molecule": "RNA", + "fullName": "BC.G2004", + "shortName": "G", + "chi": -153.88587375071322, + "glycosidicBond": "anti" + }, + { + "index": 35, + "chain": "BC", + "number": 2005, + "icode": null, + "molecule": "RNA", + "fullName": "BC.G2005", + "shortName": "G", + "chi": -148.85199128456694, + "glycosidicBond": "anti" + }, + { + "index": 36, + "chain": "BC", + "number": 2006, + "icode": null, + "molecule": "RNA", + "fullName": "BC.U2006", + "shortName": "U", + "chi": -159.43730655241544, + "glycosidicBond": "anti" + } + ], + "basePairs": [ + { + "nt1": "A.G1002", + "nt2": "AB.G1002", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "A.G1002", + "nt2": "AC.G1002", + "lw": "cHW", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "A.G1003", + "nt2": "AB.G1003", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "A.G1003", + "nt2": "AC.G1003", + "lw": "cHW", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "A.G1004", + "nt2": "AB.G1004", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "A.G1004", + "nt2": "AC.G1004", + "lw": "cHW", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "A.G1005", + "nt2": "AB.G1005", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "A.G1005", + "nt2": "AC.G1005", + "lw": "cHW", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "A.U1006", + "nt2": "AB.U1006", + "lw": "cHW", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "A.U1006", + "nt2": "AC.U1006", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "AB.G1002", + "nt2": "AA.G1002", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "AA.G1002", + "nt2": "AC.G1002", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "AB.G1003", + "nt2": "AA.G1003", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "AA.G1003", + "nt2": "AC.G1003", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "AB.G1004", + "nt2": "AA.G1004", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "AA.G1004", + "nt2": "AC.G1004", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "AB.G1005", + "nt2": "AA.G1005", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "AA.G1005", + "nt2": "AC.G1005", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "AB.U1006", + "nt2": "AA.U1006", + "lw": "cHW", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "AA.U1006", + "nt2": "AC.U1006", + "lw": "cHW", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "B.G2002", + "nt2": "BB.G2002", + "lw": "cHW", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "B.G2002", + "nt2": "BC.G2002", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "B.G2003", + "nt2": "BB.G2003", + "lw": "cHW", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "B.G2003", + "nt2": "BC.G2003", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "B.G2004", + "nt2": "BB.G2004", + "lw": "cHW", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "B.G2004", + "nt2": "BC.G2004", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "B.G2005", + "nt2": "BB.G2005", + "lw": "cHW", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "B.G2005", + "nt2": "BC.G2005", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "B.U2006", + "nt2": "BB.U2006", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "B.U2006", + "nt2": "BC.U2006", + "lw": "cHW", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "BA.G2002", + "nt2": "BB.G2002", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "BC.G2002", + "nt2": "BA.G2002", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "BA.G2003", + "nt2": "BB.G2003", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "BC.G2003", + "nt2": "BA.G2003", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "BA.G2004", + "nt2": "BB.G2004", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "BC.G2004", + "nt2": "BA.G2004", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "BA.G2005", + "nt2": "BB.G2005", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "BC.G2005", + "nt2": "BA.G2005", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "BA.U2006", + "nt2": "BB.U2006", + "lw": "cHW", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "BC.U2006", + "nt2": "BA.U2006", + "lw": "cHW", + "inTetrad": true, + "canonical": false + } + ], + "helices": [ + { + "quadruplexes": [ + { + "tetrads": [ + { + "id": "A.U1006-AC.U1006-AA.U1006-AB.U1006", + "nt1": "A.U1006", + "nt2": "AC.U1006", + "nt3": "AA.U1006", + "nt4": "AB.U1006", + "onz": "O-", + "gbaClassification": "VIIIa", + "planarityDeviation": 1.061, + "ionsChannel": [ + "NA" + ], + "ionsOutside": [ + { + "nt": "A.U1006", + "ion": "SR" + }, + { + "nt": "AA.U1006", + "ion": "SR" + }, + { + "nt": "AB.U1006", + "ion": "SR" + }, + { + "nt": "AC.U1006", + "ion": "SR" + } + ] + }, + { + "id": "A.G1005-AC.G1005-AA.G1005-AB.G1005", + "nt1": "A.G1005", + "nt2": "AC.G1005", + "nt3": "AA.G1005", + "nt4": "AB.G1005", + "onz": "O+", + "gbaClassification": "VIIIa", + "planarityDeviation": 0.7999999999999972, + "ionsChannel": [], + "ionsOutside": [] + }, + { + "id": "A.G1004-AC.G1004-AA.G1004-AB.G1004", + "nt1": "A.G1004", + "nt2": "AC.G1004", + "nt3": "AA.G1004", + "nt4": "AB.G1004", + "onz": "O+", + "gbaClassification": "VIIIa", + "planarityDeviation": 0.4059999999999988, + "ionsChannel": [ + "SR" + ], + "ionsOutside": [] + }, + { + "id": "A.G1003-AC.G1003-AA.G1003-AB.G1003", + "nt1": "A.G1003", + "nt2": "AC.G1003", + "nt3": "AA.G1003", + "nt4": "AB.G1003", + "onz": "O+", + "gbaClassification": "VIIIa", + "planarityDeviation": 0.5549999999999997, + "ionsChannel": [ + "SR" + ], + "ionsOutside": [] + }, + { + "id": "A.G1002-AC.G1002-AA.G1002-AB.G1002", + "nt1": "A.G1002", + "nt2": "AC.G1002", + "nt3": "AA.G1002", + "nt4": "AB.G1002", + "onz": "O+", + "gbaClassification": "VIIIa", + "planarityDeviation": 0.541999999999998, + "ionsChannel": [], + "ionsOutside": [ + { + "nt": "AB.G1002", + "ion": "CA" + }, + { + "nt": "AC.G1002", + "ion": "CA" + }, + { + "nt": "AA.G1002", + "ion": "CA" + }, + { + "nt": "A.G1002", + "ion": "CA" + } + ] + } + ], + "onzm": "Op*", + "loopClassification": null, + "gbaClassification": [ + "VIII" + ], + "tracts": [ + [ + "A.U1006", + "A.G1005", + "A.G1004", + "A.G1003", + "A.G1002" + ], + [ + "AC.U1006", + "AC.G1005", + "AC.G1004", + "AC.G1003", + "AC.G1002" + ], + [ + "AA.U1006", + "AA.G1005", + "AA.G1004", + "AA.G1003", + "AA.G1002" + ], + [ + "AB.U1006", + "AB.G1005", + "AB.G1004", + "AB.G1003", + "AB.G1002" + ] + ], + "loops": [] + }, + { + "tetrads": [ + { + "id": "B.G2002-BC.G2002-BA.G2002-BB.G2002", + "nt1": "B.G2002", + "nt2": "BC.G2002", + "nt3": "BA.G2002", + "nt4": "BB.G2002", + "onz": "O+", + "gbaClassification": "VIIIa", + "planarityDeviation": 0.6730000000000018, + "ionsChannel": [], + "ionsOutside": [] + }, + { + "id": "B.G2003-BC.G2003-BA.G2003-BB.G2003", + "nt1": "B.G2003", + "nt2": "BC.G2003", + "nt3": "BA.G2003", + "nt4": "BB.G2003", + "onz": "O+", + "gbaClassification": "VIIIa", + "planarityDeviation": 0.5769999999999982, + "ionsChannel": [ + "SR" + ], + "ionsOutside": [ + { + "nt": "B.G2003", + "ion": "CA" + }, + { + "nt": "BA.G2003", + "ion": "CA" + }, + { + "nt": "BB.G2003", + "ion": "CA" + }, + { + "nt": "BC.G2003", + "ion": "CA" + } + ] + }, + { + "id": "B.G2004-BC.G2004-BA.G2004-BB.G2004", + "nt1": "B.G2004", + "nt2": "BC.G2004", + "nt3": "BA.G2004", + "nt4": "BB.G2004", + "onz": "O+", + "gbaClassification": "VIIIa", + "planarityDeviation": 0.2289999999999992, + "ionsChannel": [ + "SR" + ], + "ionsOutside": [] + }, + { + "id": "B.G2005-BC.G2005-BA.G2005-BB.G2005", + "nt1": "B.G2005", + "nt2": "BC.G2005", + "nt3": "BA.G2005", + "nt4": "BB.G2005", + "onz": "O+", + "gbaClassification": "VIIIa", + "planarityDeviation": 0.7810000000000006, + "ionsChannel": [ + "NA" + ], + "ionsOutside": [] + }, + { + "id": "B.U2006-BC.U2006-BA.U2006-BB.U2006", + "nt1": "B.U2006", + "nt2": "BC.U2006", + "nt3": "BA.U2006", + "nt4": "BB.U2006", + "onz": "O-", + "gbaClassification": "VIIIa", + "planarityDeviation": 1.5840000000000005, + "ionsChannel": [ + "NA", + "NA" + ], + "ionsOutside": [] + } + ], + "onzm": "Op*", + "loopClassification": null, + "gbaClassification": [ + "VIII" + ], + "tracts": [ + [ + "B.G2002", + "B.G2003", + "B.G2004", + "B.G2005", + "B.U2006" + ], + [ + "BC.G2002", + "BC.G2003", + "BC.G2004", + "BC.G2005", + "BC.U2006" + ], + [ + "BA.G2002", + "BA.G2003", + "BA.G2004", + "BA.G2005", + "BA.U2006" + ], + [ + "BB.G2002", + "BB.G2003", + "BB.G2004", + "BB.G2005", + "BB.U2006" + ] + ], + "loops": [] + } + ], + "tetradPairs": [ + { + "tetrad1": "A.U1006-AC.U1006-AA.U1006-AB.U1006", + "tetrad2": "A.G1005-AC.G1005-AA.G1005-AB.G1005", + "direction": "parallel", + "rise": 3.366499999999995, + "twist": 39.962531742191736 + }, + { + "tetrad1": "A.G1005-AC.G1005-AA.G1005-AB.G1005", + "tetrad2": "A.G1004-AC.G1004-AA.G1004-AB.G1004", + "direction": "parallel", + "rise": 3.308000000000007, + "twist": 25.89614444631925 + }, + { + "tetrad1": "A.G1004-AC.G1004-AA.G1004-AB.G1004", + "tetrad2": "A.G1003-AC.G1003-AA.G1003-AB.G1003", + "direction": "parallel", + "rise": 3.339499999999994, + "twist": 35.81115298630443 + }, + { + "tetrad1": "A.G1003-AC.G1003-AA.G1003-AB.G1003", + "tetrad2": "A.G1002-AC.G1002-AA.G1002-AB.G1002", + "direction": "parallel", + "rise": 3.2865, + "twist": 27.11515971986803 + }, + { + "tetrad1": "A.G1002-AC.G1002-AA.G1002-AB.G1002", + "tetrad2": "B.G2002-BC.G2002-BA.G2002-BB.G2002", + "direction": "parallel", + "rise": 3.369500000000002, + "twist": 28.993180312675573 + }, + { + "tetrad1": "B.G2002-BC.G2002-BA.G2002-BB.G2002", + "tetrad2": "B.G2003-BC.G2003-BA.G2003-BB.G2003", + "direction": "parallel", + "rise": 3.371000000000002, + "twist": 27.410084968596852 + }, + { + "tetrad1": "B.G2003-BC.G2003-BA.G2003-BB.G2003", + "tetrad2": "B.G2004-BC.G2004-BA.G2004-BB.G2004", + "direction": "parallel", + "rise": 3.318000000000005, + "twist": 35.04072146975963 + }, + { + "tetrad1": "B.G2004-BC.G2004-BA.G2004-BB.G2004", + "tetrad2": "B.G2005-BC.G2005-BA.G2005-BB.G2005", + "direction": "parallel", + "rise": 3.2689999999999966, + "twist": 25.149997949938147 + }, + { + "tetrad1": "B.G2005-BC.G2005-BA.G2005-BB.G2005", + "tetrad2": "B.U2006-BC.U2006-BA.U2006-BB.U2006", + "direction": "parallel", + "rise": 7.140499999999998, + "twist": 43.40609492262336 + } + ] + } + ], + "dotBracket": { + "sequence": "UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU", + "line1": ".([{<A-.([{<A-.)]}>a-.)]}>a-.([{<A-.)]}>a-.([{<A-.)]}>a", + "line2": ".([{<A-.)]}>a-.([{<A-.)]}>a-.([{<A-.([{<A-.)]}>a-.)]}>a" + } +} +``` + +</details> + +# Funding + +This research was supported by the National Science Centre, Poland +\[2016/23/B/ST6/03931, 2019/35/B/ST6/03074\] and Mloda Kadra project +\[09/91/SBAD/0684\] from Poznan University of Technology, and carried +out in the European Centre for Bioinformatics and Genomics (Poland). The +authors also acknowledge partial support by the statutory funds of +Poznan University of Technology, Polish Ministry of Science and Higher +Education, and the Institute of Bioorganic Chemistry, PAS within +intramural financing program. + +# Bibliography + +<div id="refs" class="references csl-bib-body"> + +1. Topology-Based Classification of Tetrads and Quadruplex + Structures. M. Popenda, J. Miskiewicz, J. Sarzynska, T. Zok, M. + Szachniuk. *Bioinformatics*. 2020. 36(4):1129–1134. + doi:[10.1093/bioinformatics/btz738](https://doi.org/10.1093/bioinformatics/btz738) + +2. ElTetrado: A Tool for Identification and Classification of Tetrads + and Quadruplexes. T. Zok, M. Popenda, M. Szachniuk. *BMC + Bioinformatics*. 2020. 21(1):40. + doi:[10.1186/s12859-020-3385-1](https://doi.org/10.1186/s12859-020-3385-1) + +3. R-Chie : A Web Server and R Package for Visualizing RNA Secondary + Structures. D. Lai, J.R. Proctor, J.Y.A. Zhu, I.M. Meyer. *Nucleic + Acids Research*. 2012. 40(12):e95. + doi:[f99845](https://doi.org/f99845) + +4. Geometric Nomenclature and Classification of RNA Base Pairs. N.B. + Leontis, E. Westhof. *RNA*. 2001. 7(4):499–512. + doi:[10.1017/s1355838201002515](https://doi.org/10.1017/s1355838201002515) + +</div> + + +%package -n python3-eltetrado +Summary: Find and classify tetrads and quadruplexes in DNA/RNA 3D structure +Provides: python-eltetrado +BuildRequires: python3-devel +BuildRequires: python3-setuptools +BuildRequires: python3-pip +%description -n python3-eltetrado + + +# Project description + +This is an application to analyze base pairing patterns of DNA/RNA 3D +structures to find and classify tetrads and quadruplexes. ElTetrado +assigns tetrads to one of the ONZ classes (O, N, Z) alongside with the +directionality of the tetrad (+/-) determined by the bonds between bases +and their non-canonical interactions. The interactions follow +Leontis/Westhof classification (Leontis *et al.* 2001). Watson-Crick (W) +edge of first base in the tetrad structure exposed to the Hoogsteen (H) +edge of the next nucleobase from the same tetrad sets the tetrad +directionality, clockwise (+) or anticlockwise (-). For more details, +please refer to Zok *et al.* (2020) and Popenda *et al.* (2020) + +# Installation + +Please run: + + pip install eltetrado + +If you have both Python 2 and Python 3 installed, you need to explicitly +call `pip3`: + + pip3 install eltetrado + +# Dependencies + +The project is written in Python 3.6+ and requires +[mmcif](https://pypi.org/project/mmcif/), +[orjson](https://github.com/ijl/orjson), [NumPy](https://numpy.org/) and +[requests](https://docs.python-requests.org/en/latest/). + +Visualization is created by `R` 3.6+ script which uses +[R4RNA](https://www.e-rna.org/r-chie/) (Lai *et al.* 2012) library. The +dependency will be automatically installed if not present. + +Base pairs and stacking interactions are identified by +[RNApolis](https://github.com/tzok/rnapolis-py). + +# Usage + +ElTetrado is a command line application, which requires to be provided +with `--input` and a path to a PDB or PDBx/mmCIF file. + +By default, ElTetrado outputs textual results on the standard output. A +JSON version of the output can be obtained with `--output` switch +followed by a path where the file is supposed to be created. + +ElTetrado prepares visualization of the whole structure and of each +N4-helices, quadruplexes and tetrads. This can be supplemented with +canonical base pairs visualization when `--complete-2d` is set. All +color settings are located in the first several lines of the `quadraw.R` +file, you can easily change them without knowledge of R language. If you +want ElTetrado to not visualize anything, pass `--no-image` switch to +it. + + usage: eltetrado [-h] [-i INPUT] [-o OUTPUT] [-m MODEL] + [--stacking-mismatch STACKING_MISMATCH] [--strict] + [--no-reorder] [--complete-2d] [--no-image] + [--dssr-json DSSR_JSON] [-v] + + options: + -h, --help show this help message and exit + -i INPUT, --input INPUT + path to input PDB or PDBx/mmCIF file + -o OUTPUT, --output OUTPUT + (optional) path for output JSON file + -m MODEL, --model MODEL + (optional) model number to process + --stacking-mismatch STACKING_MISMATCH + a perfect tetrad stacking covers 4 nucleotides; this + option can be used with value 1 or 2 to allow this + number of nucleotides to be non-stacked with otherwise + well aligned tetrad [default=2] + --strict nucleotides in tetrad are found when linked only by + cWH pairing + --no-reorder chains of bi- and tetramolecular quadruplexes should + be reordered to be able to have them classified; when + this is set, chains will be processed in original + order, which for bi-/tetramolecular means that they + will likely be misclassified; use with care! + --complete-2d when set, the visualization will also show canonical + base pairs to provide context for the quadruplex + --no-image when set, the visualization will not be created at all + --dssr-json DSSR_JSON + (optional) provide a JSON file generated by DSSR to + read the secondary structure information from (use + --nmr and --json switches) + -v, --version show program's version number and exit + +# Chains reorder + +ElTetrado keeps a global and unique 5’-3’ index for every nucleotide +which is independent from residue numbers. For example, if a structure +has chain M with 60 nucleotides and chain N with 15 nucleotides, then +ElTetrado will keep index between 0 and 74 which uniquely identifies +every nucleotide. Initially, ElTetrado assigns this indices according to +the order of chains in the input file. Therefore, if M preceded N then +nucleotides in M will be indexed from 0 to 59 and in N from 60 to 74. +Otherwise, nucleotides in N will be indexed from 0 to 14 and in M from +15 to 74. + +When `--no-reorder` is present, this initial assignment is used. +Otherwise, ElTetrado exhaustively checks all permutations of chains’ +orders. Every permutation check induces recalculation of the global and +unique 5’-3’ index and in effect it changes ONZ classification of +tetrads. + +ElTetrado keeps a table of tetrad classification scores according to +these rules: + +- Type preference: `O` \> `N` \> `Z` +- Direction preference: `+` \> `-` + +The table keeps low values for preferred classes i.e. `O+` is 0, `O-` is +1 and so on up to `Z-` with score 5. For every permutation of chain +orders, ElTetrado computes sum of scores for tetrads classification +induced by 5’-3’ indexing. We select permutation with the minimum value. + +# Examples + +## 2HY9: Human telomere DNA quadruplex structure in K+ solution hybrid-1 form + + + + $ curl ftp://ftp.wwpdb.org/pub/pdb/data/structures/divided/mmCIF/my/2hy9.cif.gz | gzip -d > 2hy9.cif + $ ./eltetrado --input 2hy9.cif --output 2hy9.json + + Chain order: 1 + n4-helix with 3 tetrads + Oh* V,VI 9a -(pll) quadruplex with 3 tetrads + 1.DG4 1.DG22 1.DG18 1.DG10 cWH cWH cWH cWH O- Vb planarity=0.17 + direction=hybrid rise=3.21 twist=16.23 + 1.DG5 1.DG23 1.DG17 1.DG11 cHW cHW cHW cHW O+ Va planarity=0.1 + direction=hybrid rise=3.11 twist=27.45 + 1.DG6 1.DG24 1.DG16 1.DG12 cHW cHW cHW cHW O+ VIa planarity=0.18 + + Tracts: + 1.DG4, 1.DG5, 1.DG6 + 1.DG22, 1.DG23, 1.DG24 + 1.DG18, 1.DG17, 1.DG16 + 1.DG10, 1.DG11, 1.DG12 + + Loops: + propeller- 1.DT7, 1.DT8, 1.DA9 + lateral- 1.DT13, 1.DT14, 1.DA15 + lateral+ 1.DT19, 1.DT20, 1.DA21 + + AAAGGGTTAGGGTTAGGGTTAGGGAA + ...([{...(((...)))...)]}.. + ...([{...)]}...(((...))).. + +<details> +<summary> +Click to see the output JSON +</summary> + +``` json +{ + "metals": [], + "nucleotides": [ + { + "index": 1, + "chain": "1", + "number": 1, + "icode": null, + "molecule": "DNA", + "fullName": "1.DA1", + "shortName": "A", + "chi": 22.308282830857802, + "glycosidicBond": "syn" + }, + { + "index": 2, + "chain": "1", + "number": 2, + "icode": null, + "molecule": "DNA", + "fullName": "1.DA2", + "shortName": "A", + "chi": -123.05454402191421, + "glycosidicBond": "anti" + }, + { + "index": 3, + "chain": "1", + "number": 3, + "icode": null, + "molecule": "DNA", + "fullName": "1.DA3", + "shortName": "A", + "chi": -94.96579955603106, + "glycosidicBond": "anti" + }, + { + "index": 4, + "chain": "1", + "number": 4, + "icode": null, + "molecule": "DNA", + "fullName": "1.DG4", + "shortName": "G", + "chi": 79.28363721639316, + "glycosidicBond": "syn" + }, + { + "index": 5, + "chain": "1", + "number": 5, + "icode": null, + "molecule": "DNA", + "fullName": "1.DG5", + "shortName": "G", + "chi": -126.01709201555563, + "glycosidicBond": "anti" + }, + { + "index": 6, + "chain": "1", + "number": 6, + "icode": null, + "molecule": "DNA", + "fullName": "1.DG6", + "shortName": "G", + "chi": -127.26656202302102, + "glycosidicBond": "anti" + }, + { + "index": 7, + "chain": "1", + "number": 7, + "icode": null, + "molecule": "DNA", + "fullName": "1.DT7", + "shortName": "T", + "chi": -63.10830751967371, + "glycosidicBond": "syn" + }, + { + "index": 8, + "chain": "1", + "number": 8, + "icode": null, + "molecule": "DNA", + "fullName": "1.DT8", + "shortName": "T", + "chi": -138.79520345559828, + "glycosidicBond": "anti" + }, + { + "index": 9, + "chain": "1", + "number": 9, + "icode": null, + "molecule": "DNA", + "fullName": "1.DA9", + "shortName": "A", + "chi": -148.83990757408878, + "glycosidicBond": "anti" + }, + { + "index": 10, + "chain": "1", + "number": 10, + "icode": null, + "molecule": "DNA", + "fullName": "1.DG10", + "shortName": "G", + "chi": 58.7787525019158, + "glycosidicBond": "syn" + }, + { + "index": 11, + "chain": "1", + "number": 11, + "icode": null, + "molecule": "DNA", + "fullName": "1.DG11", + "shortName": "G", + "chi": -123.85746807924986, + "glycosidicBond": "anti" + }, + { + "index": 12, + "chain": "1", + "number": 12, + "icode": null, + "molecule": "DNA", + "fullName": "1.DG12", + "shortName": "G", + "chi": -84.36679807284759, + "glycosidicBond": "syn" + }, + { + "index": 13, + "chain": "1", + "number": 13, + "icode": null, + "molecule": "DNA", + "fullName": "1.DT13", + "shortName": "T", + "chi": -30.819029132834157, + "glycosidicBond": "syn" + }, + { + "index": 14, + "chain": "1", + "number": 14, + "icode": null, + "molecule": "DNA", + "fullName": "1.DT14", + "shortName": "T", + "chi": -168.51776782812965, + "glycosidicBond": "anti" + }, + { + "index": 15, + "chain": "1", + "number": 15, + "icode": null, + "molecule": "DNA", + "fullName": "1.DA15", + "shortName": "A", + "chi": -105.72881577106517, + "glycosidicBond": "anti" + }, + { + "index": 16, + "chain": "1", + "number": 16, + "icode": null, + "molecule": "DNA", + "fullName": "1.DG16", + "shortName": "G", + "chi": 74.3227942181243, + "glycosidicBond": "syn" + }, + { + "index": 17, + "chain": "1", + "number": 17, + "icode": null, + "molecule": "DNA", + "fullName": "1.DG17", + "shortName": "G", + "chi": 81.08424926936044, + "glycosidicBond": "syn" + }, + { + "index": 18, + "chain": "1", + "number": 18, + "icode": null, + "molecule": "DNA", + "fullName": "1.DG18", + "shortName": "G", + "chi": -122.90397217111551, + "glycosidicBond": "anti" + }, + { + "index": 19, + "chain": "1", + "number": 19, + "icode": null, + "molecule": "DNA", + "fullName": "1.DT19", + "shortName": "T", + "chi": -102.98239337113938, + "glycosidicBond": "anti" + }, + { + "index": 20, + "chain": "1", + "number": 20, + "icode": null, + "molecule": "DNA", + "fullName": "1.DT20", + "shortName": "T", + "chi": -112.1514601849715, + "glycosidicBond": "anti" + }, + { + "index": 21, + "chain": "1", + "number": 21, + "icode": null, + "molecule": "DNA", + "fullName": "1.DA21", + "shortName": "A", + "chi": -89.07113063649612, + "glycosidicBond": "syn" + }, + { + "index": 22, + "chain": "1", + "number": 22, + "icode": null, + "molecule": "DNA", + "fullName": "1.DG22", + "shortName": "G", + "chi": 83.44318693001902, + "glycosidicBond": "syn" + }, + { + "index": 23, + "chain": "1", + "number": 23, + "icode": null, + "molecule": "DNA", + "fullName": "1.DG23", + "shortName": "G", + "chi": -115.41210237198398, + "glycosidicBond": "anti" + }, + { + "index": 24, + "chain": "1", + "number": 24, + "icode": null, + "molecule": "DNA", + "fullName": "1.DG24", + "shortName": "G", + "chi": -111.14845782593531, + "glycosidicBond": "anti" + }, + { + "index": 25, + "chain": "1", + "number": 25, + "icode": null, + "molecule": "DNA", + "fullName": "1.DA25", + "shortName": "A", + "chi": -58.323530637551954, + "glycosidicBond": "syn" + }, + { + "index": 26, + "chain": "1", + "number": 26, + "icode": null, + "molecule": "DNA", + "fullName": "1.DA26", + "shortName": "A", + "chi": -90.84065243137135, + "glycosidicBond": "anti" + } + ], + "basePairs": [ + { + "nt1": "1.DA3", + "nt2": "1.DA21", + "lw": "cHW", + "inTetrad": false, + "canonical": false + }, + { + "nt1": "1.DG4", + "nt2": "1.DG10", + "lw": "cHW", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "1.DG4", + "nt2": "1.DG22", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "1.DG5", + "nt2": "1.DG11", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "1.DG5", + "nt2": "1.DG23", + "lw": "cHW", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "1.DG6", + "nt2": "1.DG12", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "1.DG6", + "nt2": "1.DG24", + "lw": "cHW", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "1.DG10", + "nt2": "1.DG18", + "lw": "cHW", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "1.DG11", + "nt2": "1.DG17", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "1.DG12", + "nt2": "1.DG16", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "1.DT14", + "nt2": "1.DA25", + "lw": "tWW", + "inTetrad": false, + "canonical": false + }, + { + "nt1": "1.DG16", + "nt2": "1.DG24", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "1.DG17", + "nt2": "1.DG23", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "1.DG18", + "nt2": "1.DG22", + "lw": "cHW", + "inTetrad": true, + "canonical": false + } + ], + "helices": [ + { + "quadruplexes": [ + { + "tetrads": [ + { + "id": "1.DG4-1.DG22-1.DG18-1.DG10", + "nt1": "1.DG4", + "nt2": "1.DG22", + "nt3": "1.DG18", + "nt4": "1.DG10", + "onz": "O-", + "gbaClassification": "Vb", + "planarityDeviation": 0.17372283960377805, + "ionsChannel": [], + "ionsOutside": [] + }, + { + "id": "1.DG5-1.DG23-1.DG17-1.DG11", + "nt1": "1.DG5", + "nt2": "1.DG23", + "nt3": "1.DG17", + "nt4": "1.DG11", + "onz": "O+", + "gbaClassification": "Va", + "planarityDeviation": 0.10474313820007483, + "ionsChannel": [], + "ionsOutside": [] + }, + { + "id": "1.DG6-1.DG24-1.DG16-1.DG12", + "nt1": "1.DG6", + "nt2": "1.DG24", + "nt3": "1.DG16", + "nt4": "1.DG12", + "onz": "O+", + "gbaClassification": "VIa", + "planarityDeviation": 0.18293509778060615, + "ionsChannel": [], + "ionsOutside": [] + } + ], + "onzm": "Oh*", + "loopClassification": { + "classification": "9a", + "loopProgression": "-(pll)" + }, + "gbaClassification": [ + "V", + "VI" + ], + "tracts": [ + [ + "1.DG4", + "1.DG5", + "1.DG6" + ], + [ + "1.DG22", + "1.DG23", + "1.DG24" + ], + [ + "1.DG18", + "1.DG17", + "1.DG16" + ], + [ + "1.DG10", + "1.DG11", + "1.DG12" + ] + ], + "loops": [ + { + "type": "propeller-", + "nucleotides": [ + "1.DT7", + "1.DT8", + "1.DA9" + ] + }, + { + "type": "lateral-", + "nucleotides": [ + "1.DT13", + "1.DT14", + "1.DA15" + ] + }, + { + "type": "lateral+", + "nucleotides": [ + "1.DT19", + "1.DT20", + "1.DA21" + ] + } + ] + } + ], + "tetradPairs": [ + { + "tetrad1": "1.DG4-1.DG22-1.DG18-1.DG10", + "tetrad2": "1.DG5-1.DG23-1.DG17-1.DG11", + "direction": "hybrid", + "rise": 3.2109650905140654, + "twist": 16.228973729066034 + }, + { + "tetrad1": "1.DG5-1.DG23-1.DG17-1.DG11", + "tetrad2": "1.DG6-1.DG24-1.DG16-1.DG12", + "direction": "hybrid", + "rise": 3.1149939255558747, + "twist": 27.448958336697046 + } + ] + } + ], + "dotBracket": { + "sequence": "AAAGGGTTAGGGTTAGGGTTAGGGAA", + "line1": "...([{...(((...)))...)]}..", + "line2": "...([{...)]}...(((...))).." + } +} +``` + +</details> + +## 4RJ1: Structural variations and solvent structure of UGGGGU quadruplexes stabilized by Sr2+ ions + + + + $ curl https://www.ebi.ac.uk/pdbe/static/entry/download/4rj1-assembly-1.cif.gz | gzip -d > 4rj1-1.cif + $ ./eltetrado --input 4rj1-1.cif --output 4rj1-1.json + + Chain order: A AB AA AC B BC BA BB + n4-helix with 10 tetrads + Op* VIII n/a quadruplex with 5 tetrads + A.U1006 AC.U1006 AA.U1006 AB.U1006 cWH cWH cWH cWH O- VIIIa planarity=1.06 ions_channel=NA ions_outside=A.U1006: [SR] AA.U1006: [SR] AB.U1006: [SR] AC.U1006: [SR] + direction=parallel rise=3.37 twist=39.96 + A.G1005 AC.G1005 AA.G1005 AB.G1005 cHW cHW cHW cHW O+ VIIIa planarity=0.8 + direction=parallel rise=3.31 twist=25.9 + A.G1004 AC.G1004 AA.G1004 AB.G1004 cHW cHW cHW cHW O+ VIIIa planarity=0.41 ions_channel=SR + direction=parallel rise=3.34 twist=35.81 + A.G1003 AC.G1003 AA.G1003 AB.G1003 cHW cHW cHW cHW O+ VIIIa planarity=0.55 ions_channel=SR + direction=parallel rise=3.29 twist=27.12 + A.G1002 AC.G1002 AA.G1002 AB.G1002 cHW cHW cHW cHW O+ VIIIa planarity=0.54 ions_outside=AB.G1002: [CA] AC.G1002: [CA] AA.G1002: [CA] A.G1002: [CA] + + Tracts: + A.U1006, A.G1005, A.G1004, A.G1003, A.G1002 + AC.U1006, AC.G1005, AC.G1004, AC.G1003, AC.G1002 + AA.U1006, AA.G1005, AA.G1004, AA.G1003, AA.G1002 + AB.U1006, AB.G1005, AB.G1004, AB.G1003, AB.G1002 + + Op* VIII n/a quadruplex with 5 tetrads + B.G2002 BC.G2002 BA.G2002 BB.G2002 cWH cWH cWH cWH O+ VIIIa planarity=0.67 + direction=parallel rise=3.37 twist=27.41 + B.G2003 BC.G2003 BA.G2003 BB.G2003 cWH cWH cWH cWH O+ VIIIa planarity=0.58 ions_channel=SR ions_outside=B.G2003: [CA] BA.G2003: [CA] BB.G2003: [CA] BC.G2003: [CA] + direction=parallel rise=3.32 twist=35.04 + B.G2004 BC.G2004 BA.G2004 BB.G2004 cWH cWH cWH cWH O+ VIIIa planarity=0.23 ions_channel=SR + direction=parallel rise=3.27 twist=25.15 + B.G2005 BC.G2005 BA.G2005 BB.G2005 cWH cWH cWH cWH O+ VIIIa planarity=0.78 ions_channel=NA + direction=parallel rise=7.14 twist=43.41 + B.U2006 BC.U2006 BA.U2006 BB.U2006 cHW cHW cHW cHW O- VIIIa planarity=1.58 ions_channel=NA,NA + + Tracts: + B.G2002, B.G2003, B.G2004, B.G2005, B.U2006 + BC.G2002, BC.G2003, BC.G2004, BC.G2005, BC.U2006 + BA.G2002, BA.G2003, BA.G2004, BA.G2005, BA.U2006 + BB.G2002, BB.G2003, BB.G2004, BB.G2005, BB.U2006 + + UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU + .([{<A-.([{<A-.)]}>a-.)]}>a-.([{<A-.)]}>a-.([{<A-.)]}>a + .([{<A-.)]}>a-.([{<A-.)]}>a-.([{<A-.([{<A-.)]}>a-.)]}>a + +<details> +<summary> +Click to see the output JSON +</summary> + +``` json +{ + "metals": [ + { + "symbol": "Sr", + "count": 8 + }, + { + "symbol": "Na", + "count": 4 + }, + { + "symbol": "Ca", + "count": 12 + } + ], + "nucleotides": [ + { + "index": 1, + "chain": "A", + "number": 1001, + "icode": null, + "molecule": "RNA", + "fullName": "A.U1001", + "shortName": "U", + "chi": -141.92671313255752, + "glycosidicBond": "anti" + }, + { + "index": 2, + "chain": "A", + "number": 1002, + "icode": null, + "molecule": "RNA", + "fullName": "A.G1002", + "shortName": "G", + "chi": -165.93034671112116, + "glycosidicBond": "anti" + }, + { + "index": 3, + "chain": "A", + "number": 1003, + "icode": null, + "molecule": "RNA", + "fullName": "A.G1003", + "shortName": "G", + "chi": -121.5652426033226, + "glycosidicBond": "anti" + }, + { + "index": 4, + "chain": "A", + "number": 1004, + "icode": null, + "molecule": "RNA", + "fullName": "A.G1004", + "shortName": "G", + "chi": -156.00957673923344, + "glycosidicBond": "anti" + }, + { + "index": 5, + "chain": "A", + "number": 1005, + "icode": null, + "molecule": "RNA", + "fullName": "A.G1005", + "shortName": "G", + "chi": -148.10051684016415, + "glycosidicBond": "anti" + }, + { + "index": 6, + "chain": "A", + "number": 1006, + "icode": null, + "molecule": "RNA", + "fullName": "A.U1006", + "shortName": "U", + "chi": -137.28005568139983, + "glycosidicBond": "anti" + }, + { + "index": 13, + "chain": "AA", + "number": 1001, + "icode": null, + "molecule": "RNA", + "fullName": "AA.U1001", + "shortName": "U", + "chi": -141.9267131325575, + "glycosidicBond": "anti" + }, + { + "index": 14, + "chain": "AA", + "number": 1002, + "icode": null, + "molecule": "RNA", + "fullName": "AA.G1002", + "shortName": "G", + "chi": -165.93034671112113, + "glycosidicBond": "anti" + }, + { + "index": 15, + "chain": "AA", + "number": 1003, + "icode": null, + "molecule": "RNA", + "fullName": "AA.G1003", + "shortName": "G", + "chi": -121.56524260332266, + "glycosidicBond": "anti" + }, + { + "index": 16, + "chain": "AA", + "number": 1004, + "icode": null, + "molecule": "RNA", + "fullName": "AA.G1004", + "shortName": "G", + "chi": -156.0095767392335, + "glycosidicBond": "anti" + }, + { + "index": 17, + "chain": "AA", + "number": 1005, + "icode": null, + "molecule": "RNA", + "fullName": "AA.G1005", + "shortName": "G", + "chi": -148.10051684016406, + "glycosidicBond": "anti" + }, + { + "index": 18, + "chain": "AA", + "number": 1006, + "icode": null, + "molecule": "RNA", + "fullName": "AA.U1006", + "shortName": "U", + "chi": -137.2800556813998, + "glycosidicBond": "anti" + }, + { + "index": 7, + "chain": "AB", + "number": 1001, + "icode": null, + "molecule": "RNA", + "fullName": "AB.U1001", + "shortName": "U", + "chi": -141.9267131325574, + "glycosidicBond": "anti" + }, + { + "index": 8, + "chain": "AB", + "number": 1002, + "icode": null, + "molecule": "RNA", + "fullName": "AB.G1002", + "shortName": "G", + "chi": -165.93034671112113, + "glycosidicBond": "anti" + }, + { + "index": 9, + "chain": "AB", + "number": 1003, + "icode": null, + "molecule": "RNA", + "fullName": "AB.G1003", + "shortName": "G", + "chi": -121.56524260332266, + "glycosidicBond": "anti" + }, + { + "index": 10, + "chain": "AB", + "number": 1004, + "icode": null, + "molecule": "RNA", + "fullName": "AB.G1004", + "shortName": "G", + "chi": -156.00957673923347, + "glycosidicBond": "anti" + }, + { + "index": 11, + "chain": "AB", + "number": 1005, + "icode": null, + "molecule": "RNA", + "fullName": "AB.G1005", + "shortName": "G", + "chi": -148.10051684016406, + "glycosidicBond": "anti" + }, + { + "index": 12, + "chain": "AB", + "number": 1006, + "icode": null, + "molecule": "RNA", + "fullName": "AB.U1006", + "shortName": "U", + "chi": -137.28005568139977, + "glycosidicBond": "anti" + }, + { + "index": 19, + "chain": "AC", + "number": 1001, + "icode": null, + "molecule": "RNA", + "fullName": "AC.U1001", + "shortName": "U", + "chi": -141.92671313255747, + "glycosidicBond": "anti" + }, + { + "index": 20, + "chain": "AC", + "number": 1002, + "icode": null, + "molecule": "RNA", + "fullName": "AC.G1002", + "shortName": "G", + "chi": -165.93034671112116, + "glycosidicBond": "anti" + }, + { + "index": 21, + "chain": "AC", + "number": 1003, + "icode": null, + "molecule": "RNA", + "fullName": "AC.G1003", + "shortName": "G", + "chi": -121.56524260332266, + "glycosidicBond": "anti" + }, + { + "index": 22, + "chain": "AC", + "number": 1004, + "icode": null, + "molecule": "RNA", + "fullName": "AC.G1004", + "shortName": "G", + "chi": -156.00957673923352, + "glycosidicBond": "anti" + }, + { + "index": 23, + "chain": "AC", + "number": 1005, + "icode": null, + "molecule": "RNA", + "fullName": "AC.G1005", + "shortName": "G", + "chi": -148.1005168401641, + "glycosidicBond": "anti" + }, + { + "index": 24, + "chain": "AC", + "number": 1006, + "icode": null, + "molecule": "RNA", + "fullName": "AC.U1006", + "shortName": "U", + "chi": -137.28005568139986, + "glycosidicBond": "anti" + }, + { + "index": 25, + "chain": "B", + "number": 2001, + "icode": null, + "molecule": "RNA", + "fullName": "B.U2001", + "shortName": "U", + "chi": -146.4615316869476, + "glycosidicBond": "anti" + }, + { + "index": 26, + "chain": "B", + "number": 2002, + "icode": null, + "molecule": "RNA", + "fullName": "B.G2002", + "shortName": "G", + "chi": -170.79660912745996, + "glycosidicBond": "anti" + }, + { + "index": 27, + "chain": "B", + "number": 2003, + "icode": null, + "molecule": "RNA", + "fullName": "B.G2003", + "shortName": "G", + "chi": -117.68718110874113, + "glycosidicBond": "anti" + }, + { + "index": 28, + "chain": "B", + "number": 2004, + "icode": null, + "molecule": "RNA", + "fullName": "B.G2004", + "shortName": "G", + "chi": -153.88587375071324, + "glycosidicBond": "anti" + }, + { + "index": 29, + "chain": "B", + "number": 2005, + "icode": null, + "molecule": "RNA", + "fullName": "B.G2005", + "shortName": "G", + "chi": -148.8519912845669, + "glycosidicBond": "anti" + }, + { + "index": 30, + "chain": "B", + "number": 2006, + "icode": null, + "molecule": "RNA", + "fullName": "B.U2006", + "shortName": "U", + "chi": -159.43730655241544, + "glycosidicBond": "anti" + }, + { + "index": 37, + "chain": "BA", + "number": 2001, + "icode": null, + "molecule": "RNA", + "fullName": "BA.U2001", + "shortName": "U", + "chi": -146.46153168694764, + "glycosidicBond": "anti" + }, + { + "index": 38, + "chain": "BA", + "number": 2002, + "icode": null, + "molecule": "RNA", + "fullName": "BA.G2002", + "shortName": "G", + "chi": -170.79660912745993, + "glycosidicBond": "anti" + }, + { + "index": 39, + "chain": "BA", + "number": 2003, + "icode": null, + "molecule": "RNA", + "fullName": "BA.G2003", + "shortName": "G", + "chi": -117.68718110874113, + "glycosidicBond": "anti" + }, + { + "index": 40, + "chain": "BA", + "number": 2004, + "icode": null, + "molecule": "RNA", + "fullName": "BA.G2004", + "shortName": "G", + "chi": -153.88587375071322, + "glycosidicBond": "anti" + }, + { + "index": 41, + "chain": "BA", + "number": 2005, + "icode": null, + "molecule": "RNA", + "fullName": "BA.G2005", + "shortName": "G", + "chi": -148.851991284567, + "glycosidicBond": "anti" + }, + { + "index": 42, + "chain": "BA", + "number": 2006, + "icode": null, + "molecule": "RNA", + "fullName": "BA.U2006", + "shortName": "U", + "chi": -159.43730655241544, + "glycosidicBond": "anti" + }, + { + "index": 43, + "chain": "BB", + "number": 2001, + "icode": null, + "molecule": "RNA", + "fullName": "BB.U2001", + "shortName": "U", + "chi": -146.4615316869476, + "glycosidicBond": "anti" + }, + { + "index": 44, + "chain": "BB", + "number": 2002, + "icode": null, + "molecule": "RNA", + "fullName": "BB.G2002", + "shortName": "G", + "chi": -170.79660912745993, + "glycosidicBond": "anti" + }, + { + "index": 45, + "chain": "BB", + "number": 2003, + "icode": null, + "molecule": "RNA", + "fullName": "BB.G2003", + "shortName": "G", + "chi": -117.68718110874106, + "glycosidicBond": "anti" + }, + { + "index": 46, + "chain": "BB", + "number": 2004, + "icode": null, + "molecule": "RNA", + "fullName": "BB.G2004", + "shortName": "G", + "chi": -153.8858737507132, + "glycosidicBond": "anti" + }, + { + "index": 47, + "chain": "BB", + "number": 2005, + "icode": null, + "molecule": "RNA", + "fullName": "BB.G2005", + "shortName": "G", + "chi": -148.85199128456696, + "glycosidicBond": "anti" + }, + { + "index": 48, + "chain": "BB", + "number": 2006, + "icode": null, + "molecule": "RNA", + "fullName": "BB.U2006", + "shortName": "U", + "chi": -159.43730655241544, + "glycosidicBond": "anti" + }, + { + "index": 31, + "chain": "BC", + "number": 2001, + "icode": null, + "molecule": "RNA", + "fullName": "BC.U2001", + "shortName": "U", + "chi": -146.4615316869476, + "glycosidicBond": "anti" + }, + { + "index": 32, + "chain": "BC", + "number": 2002, + "icode": null, + "molecule": "RNA", + "fullName": "BC.G2002", + "shortName": "G", + "chi": -170.79660912745993, + "glycosidicBond": "anti" + }, + { + "index": 33, + "chain": "BC", + "number": 2003, + "icode": null, + "molecule": "RNA", + "fullName": "BC.G2003", + "shortName": "G", + "chi": -117.68718110874121, + "glycosidicBond": "anti" + }, + { + "index": 34, + "chain": "BC", + "number": 2004, + "icode": null, + "molecule": "RNA", + "fullName": "BC.G2004", + "shortName": "G", + "chi": -153.88587375071322, + "glycosidicBond": "anti" + }, + { + "index": 35, + "chain": "BC", + "number": 2005, + "icode": null, + "molecule": "RNA", + "fullName": "BC.G2005", + "shortName": "G", + "chi": -148.85199128456694, + "glycosidicBond": "anti" + }, + { + "index": 36, + "chain": "BC", + "number": 2006, + "icode": null, + "molecule": "RNA", + "fullName": "BC.U2006", + "shortName": "U", + "chi": -159.43730655241544, + "glycosidicBond": "anti" + } + ], + "basePairs": [ + { + "nt1": "A.G1002", + "nt2": "AB.G1002", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "A.G1002", + "nt2": "AC.G1002", + "lw": "cHW", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "A.G1003", + "nt2": "AB.G1003", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "A.G1003", + "nt2": "AC.G1003", + "lw": "cHW", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "A.G1004", + "nt2": "AB.G1004", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "A.G1004", + "nt2": "AC.G1004", + "lw": "cHW", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "A.G1005", + "nt2": "AB.G1005", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "A.G1005", + "nt2": "AC.G1005", + "lw": "cHW", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "A.U1006", + "nt2": "AB.U1006", + "lw": "cHW", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "A.U1006", + "nt2": "AC.U1006", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "AB.G1002", + "nt2": "AA.G1002", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "AA.G1002", + "nt2": "AC.G1002", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "AB.G1003", + "nt2": "AA.G1003", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "AA.G1003", + "nt2": "AC.G1003", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "AB.G1004", + "nt2": "AA.G1004", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "AA.G1004", + "nt2": "AC.G1004", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "AB.G1005", + "nt2": "AA.G1005", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "AA.G1005", + "nt2": "AC.G1005", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "AB.U1006", + "nt2": "AA.U1006", + "lw": "cHW", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "AA.U1006", + "nt2": "AC.U1006", + "lw": "cHW", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "B.G2002", + "nt2": "BB.G2002", + "lw": "cHW", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "B.G2002", + "nt2": "BC.G2002", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "B.G2003", + "nt2": "BB.G2003", + "lw": "cHW", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "B.G2003", + "nt2": "BC.G2003", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "B.G2004", + "nt2": "BB.G2004", + "lw": "cHW", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "B.G2004", + "nt2": "BC.G2004", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "B.G2005", + "nt2": "BB.G2005", + "lw": "cHW", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "B.G2005", + "nt2": "BC.G2005", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "B.U2006", + "nt2": "BB.U2006", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "B.U2006", + "nt2": "BC.U2006", + "lw": "cHW", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "BA.G2002", + "nt2": "BB.G2002", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "BC.G2002", + "nt2": "BA.G2002", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "BA.G2003", + "nt2": "BB.G2003", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "BC.G2003", + "nt2": "BA.G2003", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "BA.G2004", + "nt2": "BB.G2004", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "BC.G2004", + "nt2": "BA.G2004", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "BA.G2005", + "nt2": "BB.G2005", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "BC.G2005", + "nt2": "BA.G2005", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "BA.U2006", + "nt2": "BB.U2006", + "lw": "cHW", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "BC.U2006", + "nt2": "BA.U2006", + "lw": "cHW", + "inTetrad": true, + "canonical": false + } + ], + "helices": [ + { + "quadruplexes": [ + { + "tetrads": [ + { + "id": "A.U1006-AC.U1006-AA.U1006-AB.U1006", + "nt1": "A.U1006", + "nt2": "AC.U1006", + "nt3": "AA.U1006", + "nt4": "AB.U1006", + "onz": "O-", + "gbaClassification": "VIIIa", + "planarityDeviation": 1.061, + "ionsChannel": [ + "NA" + ], + "ionsOutside": [ + { + "nt": "A.U1006", + "ion": "SR" + }, + { + "nt": "AA.U1006", + "ion": "SR" + }, + { + "nt": "AB.U1006", + "ion": "SR" + }, + { + "nt": "AC.U1006", + "ion": "SR" + } + ] + }, + { + "id": "A.G1005-AC.G1005-AA.G1005-AB.G1005", + "nt1": "A.G1005", + "nt2": "AC.G1005", + "nt3": "AA.G1005", + "nt4": "AB.G1005", + "onz": "O+", + "gbaClassification": "VIIIa", + "planarityDeviation": 0.7999999999999972, + "ionsChannel": [], + "ionsOutside": [] + }, + { + "id": "A.G1004-AC.G1004-AA.G1004-AB.G1004", + "nt1": "A.G1004", + "nt2": "AC.G1004", + "nt3": "AA.G1004", + "nt4": "AB.G1004", + "onz": "O+", + "gbaClassification": "VIIIa", + "planarityDeviation": 0.4059999999999988, + "ionsChannel": [ + "SR" + ], + "ionsOutside": [] + }, + { + "id": "A.G1003-AC.G1003-AA.G1003-AB.G1003", + "nt1": "A.G1003", + "nt2": "AC.G1003", + "nt3": "AA.G1003", + "nt4": "AB.G1003", + "onz": "O+", + "gbaClassification": "VIIIa", + "planarityDeviation": 0.5549999999999997, + "ionsChannel": [ + "SR" + ], + "ionsOutside": [] + }, + { + "id": "A.G1002-AC.G1002-AA.G1002-AB.G1002", + "nt1": "A.G1002", + "nt2": "AC.G1002", + "nt3": "AA.G1002", + "nt4": "AB.G1002", + "onz": "O+", + "gbaClassification": "VIIIa", + "planarityDeviation": 0.541999999999998, + "ionsChannel": [], + "ionsOutside": [ + { + "nt": "AB.G1002", + "ion": "CA" + }, + { + "nt": "AC.G1002", + "ion": "CA" + }, + { + "nt": "AA.G1002", + "ion": "CA" + }, + { + "nt": "A.G1002", + "ion": "CA" + } + ] + } + ], + "onzm": "Op*", + "loopClassification": null, + "gbaClassification": [ + "VIII" + ], + "tracts": [ + [ + "A.U1006", + "A.G1005", + "A.G1004", + "A.G1003", + "A.G1002" + ], + [ + "AC.U1006", + "AC.G1005", + "AC.G1004", + "AC.G1003", + "AC.G1002" + ], + [ + "AA.U1006", + "AA.G1005", + "AA.G1004", + "AA.G1003", + "AA.G1002" + ], + [ + "AB.U1006", + "AB.G1005", + "AB.G1004", + "AB.G1003", + "AB.G1002" + ] + ], + "loops": [] + }, + { + "tetrads": [ + { + "id": "B.G2002-BC.G2002-BA.G2002-BB.G2002", + "nt1": "B.G2002", + "nt2": "BC.G2002", + "nt3": "BA.G2002", + "nt4": "BB.G2002", + "onz": "O+", + "gbaClassification": "VIIIa", + "planarityDeviation": 0.6730000000000018, + "ionsChannel": [], + "ionsOutside": [] + }, + { + "id": "B.G2003-BC.G2003-BA.G2003-BB.G2003", + "nt1": "B.G2003", + "nt2": "BC.G2003", + "nt3": "BA.G2003", + "nt4": "BB.G2003", + "onz": "O+", + "gbaClassification": "VIIIa", + "planarityDeviation": 0.5769999999999982, + "ionsChannel": [ + "SR" + ], + "ionsOutside": [ + { + "nt": "B.G2003", + "ion": "CA" + }, + { + "nt": "BA.G2003", + "ion": "CA" + }, + { + "nt": "BB.G2003", + "ion": "CA" + }, + { + "nt": "BC.G2003", + "ion": "CA" + } + ] + }, + { + "id": "B.G2004-BC.G2004-BA.G2004-BB.G2004", + "nt1": "B.G2004", + "nt2": "BC.G2004", + "nt3": "BA.G2004", + "nt4": "BB.G2004", + "onz": "O+", + "gbaClassification": "VIIIa", + "planarityDeviation": 0.2289999999999992, + "ionsChannel": [ + "SR" + ], + "ionsOutside": [] + }, + { + "id": "B.G2005-BC.G2005-BA.G2005-BB.G2005", + "nt1": "B.G2005", + "nt2": "BC.G2005", + "nt3": "BA.G2005", + "nt4": "BB.G2005", + "onz": "O+", + "gbaClassification": "VIIIa", + "planarityDeviation": 0.7810000000000006, + "ionsChannel": [ + "NA" + ], + "ionsOutside": [] + }, + { + "id": "B.U2006-BC.U2006-BA.U2006-BB.U2006", + "nt1": "B.U2006", + "nt2": "BC.U2006", + "nt3": "BA.U2006", + "nt4": "BB.U2006", + "onz": "O-", + "gbaClassification": "VIIIa", + "planarityDeviation": 1.5840000000000005, + "ionsChannel": [ + "NA", + "NA" + ], + "ionsOutside": [] + } + ], + "onzm": "Op*", + "loopClassification": null, + "gbaClassification": [ + "VIII" + ], + "tracts": [ + [ + "B.G2002", + "B.G2003", + "B.G2004", + "B.G2005", + "B.U2006" + ], + [ + "BC.G2002", + "BC.G2003", + "BC.G2004", + "BC.G2005", + "BC.U2006" + ], + [ + "BA.G2002", + "BA.G2003", + "BA.G2004", + "BA.G2005", + "BA.U2006" + ], + [ + "BB.G2002", + "BB.G2003", + "BB.G2004", + "BB.G2005", + "BB.U2006" + ] + ], + "loops": [] + } + ], + "tetradPairs": [ + { + "tetrad1": "A.U1006-AC.U1006-AA.U1006-AB.U1006", + "tetrad2": "A.G1005-AC.G1005-AA.G1005-AB.G1005", + "direction": "parallel", + "rise": 3.366499999999995, + "twist": 39.962531742191736 + }, + { + "tetrad1": "A.G1005-AC.G1005-AA.G1005-AB.G1005", + "tetrad2": "A.G1004-AC.G1004-AA.G1004-AB.G1004", + "direction": "parallel", + "rise": 3.308000000000007, + "twist": 25.89614444631925 + }, + { + "tetrad1": "A.G1004-AC.G1004-AA.G1004-AB.G1004", + "tetrad2": "A.G1003-AC.G1003-AA.G1003-AB.G1003", + "direction": "parallel", + "rise": 3.339499999999994, + "twist": 35.81115298630443 + }, + { + "tetrad1": "A.G1003-AC.G1003-AA.G1003-AB.G1003", + "tetrad2": "A.G1002-AC.G1002-AA.G1002-AB.G1002", + "direction": "parallel", + "rise": 3.2865, + "twist": 27.11515971986803 + }, + { + "tetrad1": "A.G1002-AC.G1002-AA.G1002-AB.G1002", + "tetrad2": "B.G2002-BC.G2002-BA.G2002-BB.G2002", + "direction": "parallel", + "rise": 3.369500000000002, + "twist": 28.993180312675573 + }, + { + "tetrad1": "B.G2002-BC.G2002-BA.G2002-BB.G2002", + "tetrad2": "B.G2003-BC.G2003-BA.G2003-BB.G2003", + "direction": "parallel", + "rise": 3.371000000000002, + "twist": 27.410084968596852 + }, + { + "tetrad1": "B.G2003-BC.G2003-BA.G2003-BB.G2003", + "tetrad2": "B.G2004-BC.G2004-BA.G2004-BB.G2004", + "direction": "parallel", + "rise": 3.318000000000005, + "twist": 35.04072146975963 + }, + { + "tetrad1": "B.G2004-BC.G2004-BA.G2004-BB.G2004", + "tetrad2": "B.G2005-BC.G2005-BA.G2005-BB.G2005", + "direction": "parallel", + "rise": 3.2689999999999966, + "twist": 25.149997949938147 + }, + { + "tetrad1": "B.G2005-BC.G2005-BA.G2005-BB.G2005", + "tetrad2": "B.U2006-BC.U2006-BA.U2006-BB.U2006", + "direction": "parallel", + "rise": 7.140499999999998, + "twist": 43.40609492262336 + } + ] + } + ], + "dotBracket": { + "sequence": "UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU", + "line1": ".([{<A-.([{<A-.)]}>a-.)]}>a-.([{<A-.)]}>a-.([{<A-.)]}>a", + "line2": ".([{<A-.)]}>a-.([{<A-.)]}>a-.([{<A-.([{<A-.)]}>a-.)]}>a" + } +} +``` + +</details> + +# Funding + +This research was supported by the National Science Centre, Poland +\[2016/23/B/ST6/03931, 2019/35/B/ST6/03074\] and Mloda Kadra project +\[09/91/SBAD/0684\] from Poznan University of Technology, and carried +out in the European Centre for Bioinformatics and Genomics (Poland). The +authors also acknowledge partial support by the statutory funds of +Poznan University of Technology, Polish Ministry of Science and Higher +Education, and the Institute of Bioorganic Chemistry, PAS within +intramural financing program. + +# Bibliography + +<div id="refs" class="references csl-bib-body"> + +1. Topology-Based Classification of Tetrads and Quadruplex + Structures. M. Popenda, J. Miskiewicz, J. Sarzynska, T. Zok, M. + Szachniuk. *Bioinformatics*. 2020. 36(4):1129–1134. + doi:[10.1093/bioinformatics/btz738](https://doi.org/10.1093/bioinformatics/btz738) + +2. ElTetrado: A Tool for Identification and Classification of Tetrads + and Quadruplexes. T. Zok, M. Popenda, M. Szachniuk. *BMC + Bioinformatics*. 2020. 21(1):40. + doi:[10.1186/s12859-020-3385-1](https://doi.org/10.1186/s12859-020-3385-1) + +3. R-Chie : A Web Server and R Package for Visualizing RNA Secondary + Structures. D. Lai, J.R. Proctor, J.Y.A. Zhu, I.M. Meyer. *Nucleic + Acids Research*. 2012. 40(12):e95. + doi:[f99845](https://doi.org/f99845) + +4. Geometric Nomenclature and Classification of RNA Base Pairs. N.B. + Leontis, E. Westhof. *RNA*. 2001. 7(4):499–512. + doi:[10.1017/s1355838201002515](https://doi.org/10.1017/s1355838201002515) + +</div> + + +%package help +Summary: Development documents and examples for eltetrado +Provides: python3-eltetrado-doc +%description help + + +# Project description + +This is an application to analyze base pairing patterns of DNA/RNA 3D +structures to find and classify tetrads and quadruplexes. ElTetrado +assigns tetrads to one of the ONZ classes (O, N, Z) alongside with the +directionality of the tetrad (+/-) determined by the bonds between bases +and their non-canonical interactions. The interactions follow +Leontis/Westhof classification (Leontis *et al.* 2001). Watson-Crick (W) +edge of first base in the tetrad structure exposed to the Hoogsteen (H) +edge of the next nucleobase from the same tetrad sets the tetrad +directionality, clockwise (+) or anticlockwise (-). For more details, +please refer to Zok *et al.* (2020) and Popenda *et al.* (2020) + +# Installation + +Please run: + + pip install eltetrado + +If you have both Python 2 and Python 3 installed, you need to explicitly +call `pip3`: + + pip3 install eltetrado + +# Dependencies + +The project is written in Python 3.6+ and requires +[mmcif](https://pypi.org/project/mmcif/), +[orjson](https://github.com/ijl/orjson), [NumPy](https://numpy.org/) and +[requests](https://docs.python-requests.org/en/latest/). + +Visualization is created by `R` 3.6+ script which uses +[R4RNA](https://www.e-rna.org/r-chie/) (Lai *et al.* 2012) library. The +dependency will be automatically installed if not present. + +Base pairs and stacking interactions are identified by +[RNApolis](https://github.com/tzok/rnapolis-py). + +# Usage + +ElTetrado is a command line application, which requires to be provided +with `--input` and a path to a PDB or PDBx/mmCIF file. + +By default, ElTetrado outputs textual results on the standard output. A +JSON version of the output can be obtained with `--output` switch +followed by a path where the file is supposed to be created. + +ElTetrado prepares visualization of the whole structure and of each +N4-helices, quadruplexes and tetrads. This can be supplemented with +canonical base pairs visualization when `--complete-2d` is set. All +color settings are located in the first several lines of the `quadraw.R` +file, you can easily change them without knowledge of R language. If you +want ElTetrado to not visualize anything, pass `--no-image` switch to +it. + + usage: eltetrado [-h] [-i INPUT] [-o OUTPUT] [-m MODEL] + [--stacking-mismatch STACKING_MISMATCH] [--strict] + [--no-reorder] [--complete-2d] [--no-image] + [--dssr-json DSSR_JSON] [-v] + + options: + -h, --help show this help message and exit + -i INPUT, --input INPUT + path to input PDB or PDBx/mmCIF file + -o OUTPUT, --output OUTPUT + (optional) path for output JSON file + -m MODEL, --model MODEL + (optional) model number to process + --stacking-mismatch STACKING_MISMATCH + a perfect tetrad stacking covers 4 nucleotides; this + option can be used with value 1 or 2 to allow this + number of nucleotides to be non-stacked with otherwise + well aligned tetrad [default=2] + --strict nucleotides in tetrad are found when linked only by + cWH pairing + --no-reorder chains of bi- and tetramolecular quadruplexes should + be reordered to be able to have them classified; when + this is set, chains will be processed in original + order, which for bi-/tetramolecular means that they + will likely be misclassified; use with care! + --complete-2d when set, the visualization will also show canonical + base pairs to provide context for the quadruplex + --no-image when set, the visualization will not be created at all + --dssr-json DSSR_JSON + (optional) provide a JSON file generated by DSSR to + read the secondary structure information from (use + --nmr and --json switches) + -v, --version show program's version number and exit + +# Chains reorder + +ElTetrado keeps a global and unique 5’-3’ index for every nucleotide +which is independent from residue numbers. For example, if a structure +has chain M with 60 nucleotides and chain N with 15 nucleotides, then +ElTetrado will keep index between 0 and 74 which uniquely identifies +every nucleotide. Initially, ElTetrado assigns this indices according to +the order of chains in the input file. Therefore, if M preceded N then +nucleotides in M will be indexed from 0 to 59 and in N from 60 to 74. +Otherwise, nucleotides in N will be indexed from 0 to 14 and in M from +15 to 74. + +When `--no-reorder` is present, this initial assignment is used. +Otherwise, ElTetrado exhaustively checks all permutations of chains’ +orders. Every permutation check induces recalculation of the global and +unique 5’-3’ index and in effect it changes ONZ classification of +tetrads. + +ElTetrado keeps a table of tetrad classification scores according to +these rules: + +- Type preference: `O` \> `N` \> `Z` +- Direction preference: `+` \> `-` + +The table keeps low values for preferred classes i.e. `O+` is 0, `O-` is +1 and so on up to `Z-` with score 5. For every permutation of chain +orders, ElTetrado computes sum of scores for tetrads classification +induced by 5’-3’ indexing. We select permutation with the minimum value. + +# Examples + +## 2HY9: Human telomere DNA quadruplex structure in K+ solution hybrid-1 form + + + + $ curl ftp://ftp.wwpdb.org/pub/pdb/data/structures/divided/mmCIF/my/2hy9.cif.gz | gzip -d > 2hy9.cif + $ ./eltetrado --input 2hy9.cif --output 2hy9.json + + Chain order: 1 + n4-helix with 3 tetrads + Oh* V,VI 9a -(pll) quadruplex with 3 tetrads + 1.DG4 1.DG22 1.DG18 1.DG10 cWH cWH cWH cWH O- Vb planarity=0.17 + direction=hybrid rise=3.21 twist=16.23 + 1.DG5 1.DG23 1.DG17 1.DG11 cHW cHW cHW cHW O+ Va planarity=0.1 + direction=hybrid rise=3.11 twist=27.45 + 1.DG6 1.DG24 1.DG16 1.DG12 cHW cHW cHW cHW O+ VIa planarity=0.18 + + Tracts: + 1.DG4, 1.DG5, 1.DG6 + 1.DG22, 1.DG23, 1.DG24 + 1.DG18, 1.DG17, 1.DG16 + 1.DG10, 1.DG11, 1.DG12 + + Loops: + propeller- 1.DT7, 1.DT8, 1.DA9 + lateral- 1.DT13, 1.DT14, 1.DA15 + lateral+ 1.DT19, 1.DT20, 1.DA21 + + AAAGGGTTAGGGTTAGGGTTAGGGAA + ...([{...(((...)))...)]}.. + ...([{...)]}...(((...))).. + +<details> +<summary> +Click to see the output JSON +</summary> + +``` json +{ + "metals": [], + "nucleotides": [ + { + "index": 1, + "chain": "1", + "number": 1, + "icode": null, + "molecule": "DNA", + "fullName": "1.DA1", + "shortName": "A", + "chi": 22.308282830857802, + "glycosidicBond": "syn" + }, + { + "index": 2, + "chain": "1", + "number": 2, + "icode": null, + "molecule": "DNA", + "fullName": "1.DA2", + "shortName": "A", + "chi": -123.05454402191421, + "glycosidicBond": "anti" + }, + { + "index": 3, + "chain": "1", + "number": 3, + "icode": null, + "molecule": "DNA", + "fullName": "1.DA3", + "shortName": "A", + "chi": -94.96579955603106, + "glycosidicBond": "anti" + }, + { + "index": 4, + "chain": "1", + "number": 4, + "icode": null, + "molecule": "DNA", + "fullName": "1.DG4", + "shortName": "G", + "chi": 79.28363721639316, + "glycosidicBond": "syn" + }, + { + "index": 5, + "chain": "1", + "number": 5, + "icode": null, + "molecule": "DNA", + "fullName": "1.DG5", + "shortName": "G", + "chi": -126.01709201555563, + "glycosidicBond": "anti" + }, + { + "index": 6, + "chain": "1", + "number": 6, + "icode": null, + "molecule": "DNA", + "fullName": "1.DG6", + "shortName": "G", + "chi": -127.26656202302102, + "glycosidicBond": "anti" + }, + { + "index": 7, + "chain": "1", + "number": 7, + "icode": null, + "molecule": "DNA", + "fullName": "1.DT7", + "shortName": "T", + "chi": -63.10830751967371, + "glycosidicBond": "syn" + }, + { + "index": 8, + "chain": "1", + "number": 8, + "icode": null, + "molecule": "DNA", + "fullName": "1.DT8", + "shortName": "T", + "chi": -138.79520345559828, + "glycosidicBond": "anti" + }, + { + "index": 9, + "chain": "1", + "number": 9, + "icode": null, + "molecule": "DNA", + "fullName": "1.DA9", + "shortName": "A", + "chi": -148.83990757408878, + "glycosidicBond": "anti" + }, + { + "index": 10, + "chain": "1", + "number": 10, + "icode": null, + "molecule": "DNA", + "fullName": "1.DG10", + "shortName": "G", + "chi": 58.7787525019158, + "glycosidicBond": "syn" + }, + { + "index": 11, + "chain": "1", + "number": 11, + "icode": null, + "molecule": "DNA", + "fullName": "1.DG11", + "shortName": "G", + "chi": -123.85746807924986, + "glycosidicBond": "anti" + }, + { + "index": 12, + "chain": "1", + "number": 12, + "icode": null, + "molecule": "DNA", + "fullName": "1.DG12", + "shortName": "G", + "chi": -84.36679807284759, + "glycosidicBond": "syn" + }, + { + "index": 13, + "chain": "1", + "number": 13, + "icode": null, + "molecule": "DNA", + "fullName": "1.DT13", + "shortName": "T", + "chi": -30.819029132834157, + "glycosidicBond": "syn" + }, + { + "index": 14, + "chain": "1", + "number": 14, + "icode": null, + "molecule": "DNA", + "fullName": "1.DT14", + "shortName": "T", + "chi": -168.51776782812965, + "glycosidicBond": "anti" + }, + { + "index": 15, + "chain": "1", + "number": 15, + "icode": null, + "molecule": "DNA", + "fullName": "1.DA15", + "shortName": "A", + "chi": -105.72881577106517, + "glycosidicBond": "anti" + }, + { + "index": 16, + "chain": "1", + "number": 16, + "icode": null, + "molecule": "DNA", + "fullName": "1.DG16", + "shortName": "G", + "chi": 74.3227942181243, + "glycosidicBond": "syn" + }, + { + "index": 17, + "chain": "1", + "number": 17, + "icode": null, + "molecule": "DNA", + "fullName": "1.DG17", + "shortName": "G", + "chi": 81.08424926936044, + "glycosidicBond": "syn" + }, + { + "index": 18, + "chain": "1", + "number": 18, + "icode": null, + "molecule": "DNA", + "fullName": "1.DG18", + "shortName": "G", + "chi": -122.90397217111551, + "glycosidicBond": "anti" + }, + { + "index": 19, + "chain": "1", + "number": 19, + "icode": null, + "molecule": "DNA", + "fullName": "1.DT19", + "shortName": "T", + "chi": -102.98239337113938, + "glycosidicBond": "anti" + }, + { + "index": 20, + "chain": "1", + "number": 20, + "icode": null, + "molecule": "DNA", + "fullName": "1.DT20", + "shortName": "T", + "chi": -112.1514601849715, + "glycosidicBond": "anti" + }, + { + "index": 21, + "chain": "1", + "number": 21, + "icode": null, + "molecule": "DNA", + "fullName": "1.DA21", + "shortName": "A", + "chi": -89.07113063649612, + "glycosidicBond": "syn" + }, + { + "index": 22, + "chain": "1", + "number": 22, + "icode": null, + "molecule": "DNA", + "fullName": "1.DG22", + "shortName": "G", + "chi": 83.44318693001902, + "glycosidicBond": "syn" + }, + { + "index": 23, + "chain": "1", + "number": 23, + "icode": null, + "molecule": "DNA", + "fullName": "1.DG23", + "shortName": "G", + "chi": -115.41210237198398, + "glycosidicBond": "anti" + }, + { + "index": 24, + "chain": "1", + "number": 24, + "icode": null, + "molecule": "DNA", + "fullName": "1.DG24", + "shortName": "G", + "chi": -111.14845782593531, + "glycosidicBond": "anti" + }, + { + "index": 25, + "chain": "1", + "number": 25, + "icode": null, + "molecule": "DNA", + "fullName": "1.DA25", + "shortName": "A", + "chi": -58.323530637551954, + "glycosidicBond": "syn" + }, + { + "index": 26, + "chain": "1", + "number": 26, + "icode": null, + "molecule": "DNA", + "fullName": "1.DA26", + "shortName": "A", + "chi": -90.84065243137135, + "glycosidicBond": "anti" + } + ], + "basePairs": [ + { + "nt1": "1.DA3", + "nt2": "1.DA21", + "lw": "cHW", + "inTetrad": false, + "canonical": false + }, + { + "nt1": "1.DG4", + "nt2": "1.DG10", + "lw": "cHW", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "1.DG4", + "nt2": "1.DG22", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "1.DG5", + "nt2": "1.DG11", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "1.DG5", + "nt2": "1.DG23", + "lw": "cHW", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "1.DG6", + "nt2": "1.DG12", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "1.DG6", + "nt2": "1.DG24", + "lw": "cHW", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "1.DG10", + "nt2": "1.DG18", + "lw": "cHW", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "1.DG11", + "nt2": "1.DG17", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "1.DG12", + "nt2": "1.DG16", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "1.DT14", + "nt2": "1.DA25", + "lw": "tWW", + "inTetrad": false, + "canonical": false + }, + { + "nt1": "1.DG16", + "nt2": "1.DG24", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "1.DG17", + "nt2": "1.DG23", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "1.DG18", + "nt2": "1.DG22", + "lw": "cHW", + "inTetrad": true, + "canonical": false + } + ], + "helices": [ + { + "quadruplexes": [ + { + "tetrads": [ + { + "id": "1.DG4-1.DG22-1.DG18-1.DG10", + "nt1": "1.DG4", + "nt2": "1.DG22", + "nt3": "1.DG18", + "nt4": "1.DG10", + "onz": "O-", + "gbaClassification": "Vb", + "planarityDeviation": 0.17372283960377805, + "ionsChannel": [], + "ionsOutside": [] + }, + { + "id": "1.DG5-1.DG23-1.DG17-1.DG11", + "nt1": "1.DG5", + "nt2": "1.DG23", + "nt3": "1.DG17", + "nt4": "1.DG11", + "onz": "O+", + "gbaClassification": "Va", + "planarityDeviation": 0.10474313820007483, + "ionsChannel": [], + "ionsOutside": [] + }, + { + "id": "1.DG6-1.DG24-1.DG16-1.DG12", + "nt1": "1.DG6", + "nt2": "1.DG24", + "nt3": "1.DG16", + "nt4": "1.DG12", + "onz": "O+", + "gbaClassification": "VIa", + "planarityDeviation": 0.18293509778060615, + "ionsChannel": [], + "ionsOutside": [] + } + ], + "onzm": "Oh*", + "loopClassification": { + "classification": "9a", + "loopProgression": "-(pll)" + }, + "gbaClassification": [ + "V", + "VI" + ], + "tracts": [ + [ + "1.DG4", + "1.DG5", + "1.DG6" + ], + [ + "1.DG22", + "1.DG23", + "1.DG24" + ], + [ + "1.DG18", + "1.DG17", + "1.DG16" + ], + [ + "1.DG10", + "1.DG11", + "1.DG12" + ] + ], + "loops": [ + { + "type": "propeller-", + "nucleotides": [ + "1.DT7", + "1.DT8", + "1.DA9" + ] + }, + { + "type": "lateral-", + "nucleotides": [ + "1.DT13", + "1.DT14", + "1.DA15" + ] + }, + { + "type": "lateral+", + "nucleotides": [ + "1.DT19", + "1.DT20", + "1.DA21" + ] + } + ] + } + ], + "tetradPairs": [ + { + "tetrad1": "1.DG4-1.DG22-1.DG18-1.DG10", + "tetrad2": "1.DG5-1.DG23-1.DG17-1.DG11", + "direction": "hybrid", + "rise": 3.2109650905140654, + "twist": 16.228973729066034 + }, + { + "tetrad1": "1.DG5-1.DG23-1.DG17-1.DG11", + "tetrad2": "1.DG6-1.DG24-1.DG16-1.DG12", + "direction": "hybrid", + "rise": 3.1149939255558747, + "twist": 27.448958336697046 + } + ] + } + ], + "dotBracket": { + "sequence": "AAAGGGTTAGGGTTAGGGTTAGGGAA", + "line1": "...([{...(((...)))...)]}..", + "line2": "...([{...)]}...(((...))).." + } +} +``` + +</details> + +## 4RJ1: Structural variations and solvent structure of UGGGGU quadruplexes stabilized by Sr2+ ions + + + + $ curl https://www.ebi.ac.uk/pdbe/static/entry/download/4rj1-assembly-1.cif.gz | gzip -d > 4rj1-1.cif + $ ./eltetrado --input 4rj1-1.cif --output 4rj1-1.json + + Chain order: A AB AA AC B BC BA BB + n4-helix with 10 tetrads + Op* VIII n/a quadruplex with 5 tetrads + A.U1006 AC.U1006 AA.U1006 AB.U1006 cWH cWH cWH cWH O- VIIIa planarity=1.06 ions_channel=NA ions_outside=A.U1006: [SR] AA.U1006: [SR] AB.U1006: [SR] AC.U1006: [SR] + direction=parallel rise=3.37 twist=39.96 + A.G1005 AC.G1005 AA.G1005 AB.G1005 cHW cHW cHW cHW O+ VIIIa planarity=0.8 + direction=parallel rise=3.31 twist=25.9 + A.G1004 AC.G1004 AA.G1004 AB.G1004 cHW cHW cHW cHW O+ VIIIa planarity=0.41 ions_channel=SR + direction=parallel rise=3.34 twist=35.81 + A.G1003 AC.G1003 AA.G1003 AB.G1003 cHW cHW cHW cHW O+ VIIIa planarity=0.55 ions_channel=SR + direction=parallel rise=3.29 twist=27.12 + A.G1002 AC.G1002 AA.G1002 AB.G1002 cHW cHW cHW cHW O+ VIIIa planarity=0.54 ions_outside=AB.G1002: [CA] AC.G1002: [CA] AA.G1002: [CA] A.G1002: [CA] + + Tracts: + A.U1006, A.G1005, A.G1004, A.G1003, A.G1002 + AC.U1006, AC.G1005, AC.G1004, AC.G1003, AC.G1002 + AA.U1006, AA.G1005, AA.G1004, AA.G1003, AA.G1002 + AB.U1006, AB.G1005, AB.G1004, AB.G1003, AB.G1002 + + Op* VIII n/a quadruplex with 5 tetrads + B.G2002 BC.G2002 BA.G2002 BB.G2002 cWH cWH cWH cWH O+ VIIIa planarity=0.67 + direction=parallel rise=3.37 twist=27.41 + B.G2003 BC.G2003 BA.G2003 BB.G2003 cWH cWH cWH cWH O+ VIIIa planarity=0.58 ions_channel=SR ions_outside=B.G2003: [CA] BA.G2003: [CA] BB.G2003: [CA] BC.G2003: [CA] + direction=parallel rise=3.32 twist=35.04 + B.G2004 BC.G2004 BA.G2004 BB.G2004 cWH cWH cWH cWH O+ VIIIa planarity=0.23 ions_channel=SR + direction=parallel rise=3.27 twist=25.15 + B.G2005 BC.G2005 BA.G2005 BB.G2005 cWH cWH cWH cWH O+ VIIIa planarity=0.78 ions_channel=NA + direction=parallel rise=7.14 twist=43.41 + B.U2006 BC.U2006 BA.U2006 BB.U2006 cHW cHW cHW cHW O- VIIIa planarity=1.58 ions_channel=NA,NA + + Tracts: + B.G2002, B.G2003, B.G2004, B.G2005, B.U2006 + BC.G2002, BC.G2003, BC.G2004, BC.G2005, BC.U2006 + BA.G2002, BA.G2003, BA.G2004, BA.G2005, BA.U2006 + BB.G2002, BB.G2003, BB.G2004, BB.G2005, BB.U2006 + + UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU + .([{<A-.([{<A-.)]}>a-.)]}>a-.([{<A-.)]}>a-.([{<A-.)]}>a + .([{<A-.)]}>a-.([{<A-.)]}>a-.([{<A-.([{<A-.)]}>a-.)]}>a + +<details> +<summary> +Click to see the output JSON +</summary> + +``` json +{ + "metals": [ + { + "symbol": "Sr", + "count": 8 + }, + { + "symbol": "Na", + "count": 4 + }, + { + "symbol": "Ca", + "count": 12 + } + ], + "nucleotides": [ + { + "index": 1, + "chain": "A", + "number": 1001, + "icode": null, + "molecule": "RNA", + "fullName": "A.U1001", + "shortName": "U", + "chi": -141.92671313255752, + "glycosidicBond": "anti" + }, + { + "index": 2, + "chain": "A", + "number": 1002, + "icode": null, + "molecule": "RNA", + "fullName": "A.G1002", + "shortName": "G", + "chi": -165.93034671112116, + "glycosidicBond": "anti" + }, + { + "index": 3, + "chain": "A", + "number": 1003, + "icode": null, + "molecule": "RNA", + "fullName": "A.G1003", + "shortName": "G", + "chi": -121.5652426033226, + "glycosidicBond": "anti" + }, + { + "index": 4, + "chain": "A", + "number": 1004, + "icode": null, + "molecule": "RNA", + "fullName": "A.G1004", + "shortName": "G", + "chi": -156.00957673923344, + "glycosidicBond": "anti" + }, + { + "index": 5, + "chain": "A", + "number": 1005, + "icode": null, + "molecule": "RNA", + "fullName": "A.G1005", + "shortName": "G", + "chi": -148.10051684016415, + "glycosidicBond": "anti" + }, + { + "index": 6, + "chain": "A", + "number": 1006, + "icode": null, + "molecule": "RNA", + "fullName": "A.U1006", + "shortName": "U", + "chi": -137.28005568139983, + "glycosidicBond": "anti" + }, + { + "index": 13, + "chain": "AA", + "number": 1001, + "icode": null, + "molecule": "RNA", + "fullName": "AA.U1001", + "shortName": "U", + "chi": -141.9267131325575, + "glycosidicBond": "anti" + }, + { + "index": 14, + "chain": "AA", + "number": 1002, + "icode": null, + "molecule": "RNA", + "fullName": "AA.G1002", + "shortName": "G", + "chi": -165.93034671112113, + "glycosidicBond": "anti" + }, + { + "index": 15, + "chain": "AA", + "number": 1003, + "icode": null, + "molecule": "RNA", + "fullName": "AA.G1003", + "shortName": "G", + "chi": -121.56524260332266, + "glycosidicBond": "anti" + }, + { + "index": 16, + "chain": "AA", + "number": 1004, + "icode": null, + "molecule": "RNA", + "fullName": "AA.G1004", + "shortName": "G", + "chi": -156.0095767392335, + "glycosidicBond": "anti" + }, + { + "index": 17, + "chain": "AA", + "number": 1005, + "icode": null, + "molecule": "RNA", + "fullName": "AA.G1005", + "shortName": "G", + "chi": -148.10051684016406, + "glycosidicBond": "anti" + }, + { + "index": 18, + "chain": "AA", + "number": 1006, + "icode": null, + "molecule": "RNA", + "fullName": "AA.U1006", + "shortName": "U", + "chi": -137.2800556813998, + "glycosidicBond": "anti" + }, + { + "index": 7, + "chain": "AB", + "number": 1001, + "icode": null, + "molecule": "RNA", + "fullName": "AB.U1001", + "shortName": "U", + "chi": -141.9267131325574, + "glycosidicBond": "anti" + }, + { + "index": 8, + "chain": "AB", + "number": 1002, + "icode": null, + "molecule": "RNA", + "fullName": "AB.G1002", + "shortName": "G", + "chi": -165.93034671112113, + "glycosidicBond": "anti" + }, + { + "index": 9, + "chain": "AB", + "number": 1003, + "icode": null, + "molecule": "RNA", + "fullName": "AB.G1003", + "shortName": "G", + "chi": -121.56524260332266, + "glycosidicBond": "anti" + }, + { + "index": 10, + "chain": "AB", + "number": 1004, + "icode": null, + "molecule": "RNA", + "fullName": "AB.G1004", + "shortName": "G", + "chi": -156.00957673923347, + "glycosidicBond": "anti" + }, + { + "index": 11, + "chain": "AB", + "number": 1005, + "icode": null, + "molecule": "RNA", + "fullName": "AB.G1005", + "shortName": "G", + "chi": -148.10051684016406, + "glycosidicBond": "anti" + }, + { + "index": 12, + "chain": "AB", + "number": 1006, + "icode": null, + "molecule": "RNA", + "fullName": "AB.U1006", + "shortName": "U", + "chi": -137.28005568139977, + "glycosidicBond": "anti" + }, + { + "index": 19, + "chain": "AC", + "number": 1001, + "icode": null, + "molecule": "RNA", + "fullName": "AC.U1001", + "shortName": "U", + "chi": -141.92671313255747, + "glycosidicBond": "anti" + }, + { + "index": 20, + "chain": "AC", + "number": 1002, + "icode": null, + "molecule": "RNA", + "fullName": "AC.G1002", + "shortName": "G", + "chi": -165.93034671112116, + "glycosidicBond": "anti" + }, + { + "index": 21, + "chain": "AC", + "number": 1003, + "icode": null, + "molecule": "RNA", + "fullName": "AC.G1003", + "shortName": "G", + "chi": -121.56524260332266, + "glycosidicBond": "anti" + }, + { + "index": 22, + "chain": "AC", + "number": 1004, + "icode": null, + "molecule": "RNA", + "fullName": "AC.G1004", + "shortName": "G", + "chi": -156.00957673923352, + "glycosidicBond": "anti" + }, + { + "index": 23, + "chain": "AC", + "number": 1005, + "icode": null, + "molecule": "RNA", + "fullName": "AC.G1005", + "shortName": "G", + "chi": -148.1005168401641, + "glycosidicBond": "anti" + }, + { + "index": 24, + "chain": "AC", + "number": 1006, + "icode": null, + "molecule": "RNA", + "fullName": "AC.U1006", + "shortName": "U", + "chi": -137.28005568139986, + "glycosidicBond": "anti" + }, + { + "index": 25, + "chain": "B", + "number": 2001, + "icode": null, + "molecule": "RNA", + "fullName": "B.U2001", + "shortName": "U", + "chi": -146.4615316869476, + "glycosidicBond": "anti" + }, + { + "index": 26, + "chain": "B", + "number": 2002, + "icode": null, + "molecule": "RNA", + "fullName": "B.G2002", + "shortName": "G", + "chi": -170.79660912745996, + "glycosidicBond": "anti" + }, + { + "index": 27, + "chain": "B", + "number": 2003, + "icode": null, + "molecule": "RNA", + "fullName": "B.G2003", + "shortName": "G", + "chi": -117.68718110874113, + "glycosidicBond": "anti" + }, + { + "index": 28, + "chain": "B", + "number": 2004, + "icode": null, + "molecule": "RNA", + "fullName": "B.G2004", + "shortName": "G", + "chi": -153.88587375071324, + "glycosidicBond": "anti" + }, + { + "index": 29, + "chain": "B", + "number": 2005, + "icode": null, + "molecule": "RNA", + "fullName": "B.G2005", + "shortName": "G", + "chi": -148.8519912845669, + "glycosidicBond": "anti" + }, + { + "index": 30, + "chain": "B", + "number": 2006, + "icode": null, + "molecule": "RNA", + "fullName": "B.U2006", + "shortName": "U", + "chi": -159.43730655241544, + "glycosidicBond": "anti" + }, + { + "index": 37, + "chain": "BA", + "number": 2001, + "icode": null, + "molecule": "RNA", + "fullName": "BA.U2001", + "shortName": "U", + "chi": -146.46153168694764, + "glycosidicBond": "anti" + }, + { + "index": 38, + "chain": "BA", + "number": 2002, + "icode": null, + "molecule": "RNA", + "fullName": "BA.G2002", + "shortName": "G", + "chi": -170.79660912745993, + "glycosidicBond": "anti" + }, + { + "index": 39, + "chain": "BA", + "number": 2003, + "icode": null, + "molecule": "RNA", + "fullName": "BA.G2003", + "shortName": "G", + "chi": -117.68718110874113, + "glycosidicBond": "anti" + }, + { + "index": 40, + "chain": "BA", + "number": 2004, + "icode": null, + "molecule": "RNA", + "fullName": "BA.G2004", + "shortName": "G", + "chi": -153.88587375071322, + "glycosidicBond": "anti" + }, + { + "index": 41, + "chain": "BA", + "number": 2005, + "icode": null, + "molecule": "RNA", + "fullName": "BA.G2005", + "shortName": "G", + "chi": -148.851991284567, + "glycosidicBond": "anti" + }, + { + "index": 42, + "chain": "BA", + "number": 2006, + "icode": null, + "molecule": "RNA", + "fullName": "BA.U2006", + "shortName": "U", + "chi": -159.43730655241544, + "glycosidicBond": "anti" + }, + { + "index": 43, + "chain": "BB", + "number": 2001, + "icode": null, + "molecule": "RNA", + "fullName": "BB.U2001", + "shortName": "U", + "chi": -146.4615316869476, + "glycosidicBond": "anti" + }, + { + "index": 44, + "chain": "BB", + "number": 2002, + "icode": null, + "molecule": "RNA", + "fullName": "BB.G2002", + "shortName": "G", + "chi": -170.79660912745993, + "glycosidicBond": "anti" + }, + { + "index": 45, + "chain": "BB", + "number": 2003, + "icode": null, + "molecule": "RNA", + "fullName": "BB.G2003", + "shortName": "G", + "chi": -117.68718110874106, + "glycosidicBond": "anti" + }, + { + "index": 46, + "chain": "BB", + "number": 2004, + "icode": null, + "molecule": "RNA", + "fullName": "BB.G2004", + "shortName": "G", + "chi": -153.8858737507132, + "glycosidicBond": "anti" + }, + { + "index": 47, + "chain": "BB", + "number": 2005, + "icode": null, + "molecule": "RNA", + "fullName": "BB.G2005", + "shortName": "G", + "chi": -148.85199128456696, + "glycosidicBond": "anti" + }, + { + "index": 48, + "chain": "BB", + "number": 2006, + "icode": null, + "molecule": "RNA", + "fullName": "BB.U2006", + "shortName": "U", + "chi": -159.43730655241544, + "glycosidicBond": "anti" + }, + { + "index": 31, + "chain": "BC", + "number": 2001, + "icode": null, + "molecule": "RNA", + "fullName": "BC.U2001", + "shortName": "U", + "chi": -146.4615316869476, + "glycosidicBond": "anti" + }, + { + "index": 32, + "chain": "BC", + "number": 2002, + "icode": null, + "molecule": "RNA", + "fullName": "BC.G2002", + "shortName": "G", + "chi": -170.79660912745993, + "glycosidicBond": "anti" + }, + { + "index": 33, + "chain": "BC", + "number": 2003, + "icode": null, + "molecule": "RNA", + "fullName": "BC.G2003", + "shortName": "G", + "chi": -117.68718110874121, + "glycosidicBond": "anti" + }, + { + "index": 34, + "chain": "BC", + "number": 2004, + "icode": null, + "molecule": "RNA", + "fullName": "BC.G2004", + "shortName": "G", + "chi": -153.88587375071322, + "glycosidicBond": "anti" + }, + { + "index": 35, + "chain": "BC", + "number": 2005, + "icode": null, + "molecule": "RNA", + "fullName": "BC.G2005", + "shortName": "G", + "chi": -148.85199128456694, + "glycosidicBond": "anti" + }, + { + "index": 36, + "chain": "BC", + "number": 2006, + "icode": null, + "molecule": "RNA", + "fullName": "BC.U2006", + "shortName": "U", + "chi": -159.43730655241544, + "glycosidicBond": "anti" + } + ], + "basePairs": [ + { + "nt1": "A.G1002", + "nt2": "AB.G1002", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "A.G1002", + "nt2": "AC.G1002", + "lw": "cHW", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "A.G1003", + "nt2": "AB.G1003", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "A.G1003", + "nt2": "AC.G1003", + "lw": "cHW", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "A.G1004", + "nt2": "AB.G1004", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "A.G1004", + "nt2": "AC.G1004", + "lw": "cHW", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "A.G1005", + "nt2": "AB.G1005", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "A.G1005", + "nt2": "AC.G1005", + "lw": "cHW", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "A.U1006", + "nt2": "AB.U1006", + "lw": "cHW", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "A.U1006", + "nt2": "AC.U1006", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "AB.G1002", + "nt2": "AA.G1002", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "AA.G1002", + "nt2": "AC.G1002", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "AB.G1003", + "nt2": "AA.G1003", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "AA.G1003", + "nt2": "AC.G1003", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "AB.G1004", + "nt2": "AA.G1004", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "AA.G1004", + "nt2": "AC.G1004", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "AB.G1005", + "nt2": "AA.G1005", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "AA.G1005", + "nt2": "AC.G1005", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "AB.U1006", + "nt2": "AA.U1006", + "lw": "cHW", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "AA.U1006", + "nt2": "AC.U1006", + "lw": "cHW", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "B.G2002", + "nt2": "BB.G2002", + "lw": "cHW", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "B.G2002", + "nt2": "BC.G2002", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "B.G2003", + "nt2": "BB.G2003", + "lw": "cHW", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "B.G2003", + "nt2": "BC.G2003", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "B.G2004", + "nt2": "BB.G2004", + "lw": "cHW", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "B.G2004", + "nt2": "BC.G2004", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "B.G2005", + "nt2": "BB.G2005", + "lw": "cHW", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "B.G2005", + "nt2": "BC.G2005", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "B.U2006", + "nt2": "BB.U2006", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "B.U2006", + "nt2": "BC.U2006", + "lw": "cHW", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "BA.G2002", + "nt2": "BB.G2002", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "BC.G2002", + "nt2": "BA.G2002", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "BA.G2003", + "nt2": "BB.G2003", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "BC.G2003", + "nt2": "BA.G2003", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "BA.G2004", + "nt2": "BB.G2004", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "BC.G2004", + "nt2": "BA.G2004", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "BA.G2005", + "nt2": "BB.G2005", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "BC.G2005", + "nt2": "BA.G2005", + "lw": "cWH", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "BA.U2006", + "nt2": "BB.U2006", + "lw": "cHW", + "inTetrad": true, + "canonical": false + }, + { + "nt1": "BC.U2006", + "nt2": "BA.U2006", + "lw": "cHW", + "inTetrad": true, + "canonical": false + } + ], + "helices": [ + { + "quadruplexes": [ + { + "tetrads": [ + { + "id": "A.U1006-AC.U1006-AA.U1006-AB.U1006", + "nt1": "A.U1006", + "nt2": "AC.U1006", + "nt3": "AA.U1006", + "nt4": "AB.U1006", + "onz": "O-", + "gbaClassification": "VIIIa", + "planarityDeviation": 1.061, + "ionsChannel": [ + "NA" + ], + "ionsOutside": [ + { + "nt": "A.U1006", + "ion": "SR" + }, + { + "nt": "AA.U1006", + "ion": "SR" + }, + { + "nt": "AB.U1006", + "ion": "SR" + }, + { + "nt": "AC.U1006", + "ion": "SR" + } + ] + }, + { + "id": "A.G1005-AC.G1005-AA.G1005-AB.G1005", + "nt1": "A.G1005", + "nt2": "AC.G1005", + "nt3": "AA.G1005", + "nt4": "AB.G1005", + "onz": "O+", + "gbaClassification": "VIIIa", + "planarityDeviation": 0.7999999999999972, + "ionsChannel": [], + "ionsOutside": [] + }, + { + "id": "A.G1004-AC.G1004-AA.G1004-AB.G1004", + "nt1": "A.G1004", + "nt2": "AC.G1004", + "nt3": "AA.G1004", + "nt4": "AB.G1004", + "onz": "O+", + "gbaClassification": "VIIIa", + "planarityDeviation": 0.4059999999999988, + "ionsChannel": [ + "SR" + ], + "ionsOutside": [] + }, + { + "id": "A.G1003-AC.G1003-AA.G1003-AB.G1003", + "nt1": "A.G1003", + "nt2": "AC.G1003", + "nt3": "AA.G1003", + "nt4": "AB.G1003", + "onz": "O+", + "gbaClassification": "VIIIa", + "planarityDeviation": 0.5549999999999997, + "ionsChannel": [ + "SR" + ], + "ionsOutside": [] + }, + { + "id": "A.G1002-AC.G1002-AA.G1002-AB.G1002", + "nt1": "A.G1002", + "nt2": "AC.G1002", + "nt3": "AA.G1002", + "nt4": "AB.G1002", + "onz": "O+", + "gbaClassification": "VIIIa", + "planarityDeviation": 0.541999999999998, + "ionsChannel": [], + "ionsOutside": [ + { + "nt": "AB.G1002", + "ion": "CA" + }, + { + "nt": "AC.G1002", + "ion": "CA" + }, + { + "nt": "AA.G1002", + "ion": "CA" + }, + { + "nt": "A.G1002", + "ion": "CA" + } + ] + } + ], + "onzm": "Op*", + "loopClassification": null, + "gbaClassification": [ + "VIII" + ], + "tracts": [ + [ + "A.U1006", + "A.G1005", + "A.G1004", + "A.G1003", + "A.G1002" + ], + [ + "AC.U1006", + "AC.G1005", + "AC.G1004", + "AC.G1003", + "AC.G1002" + ], + [ + "AA.U1006", + "AA.G1005", + "AA.G1004", + "AA.G1003", + "AA.G1002" + ], + [ + "AB.U1006", + "AB.G1005", + "AB.G1004", + "AB.G1003", + "AB.G1002" + ] + ], + "loops": [] + }, + { + "tetrads": [ + { + "id": "B.G2002-BC.G2002-BA.G2002-BB.G2002", + "nt1": "B.G2002", + "nt2": "BC.G2002", + "nt3": "BA.G2002", + "nt4": "BB.G2002", + "onz": "O+", + "gbaClassification": "VIIIa", + "planarityDeviation": 0.6730000000000018, + "ionsChannel": [], + "ionsOutside": [] + }, + { + "id": "B.G2003-BC.G2003-BA.G2003-BB.G2003", + "nt1": "B.G2003", + "nt2": "BC.G2003", + "nt3": "BA.G2003", + "nt4": "BB.G2003", + "onz": "O+", + "gbaClassification": "VIIIa", + "planarityDeviation": 0.5769999999999982, + "ionsChannel": [ + "SR" + ], + "ionsOutside": [ + { + "nt": "B.G2003", + "ion": "CA" + }, + { + "nt": "BA.G2003", + "ion": "CA" + }, + { + "nt": "BB.G2003", + "ion": "CA" + }, + { + "nt": "BC.G2003", + "ion": "CA" + } + ] + }, + { + "id": "B.G2004-BC.G2004-BA.G2004-BB.G2004", + "nt1": "B.G2004", + "nt2": "BC.G2004", + "nt3": "BA.G2004", + "nt4": "BB.G2004", + "onz": "O+", + "gbaClassification": "VIIIa", + "planarityDeviation": 0.2289999999999992, + "ionsChannel": [ + "SR" + ], + "ionsOutside": [] + }, + { + "id": "B.G2005-BC.G2005-BA.G2005-BB.G2005", + "nt1": "B.G2005", + "nt2": "BC.G2005", + "nt3": "BA.G2005", + "nt4": "BB.G2005", + "onz": "O+", + "gbaClassification": "VIIIa", + "planarityDeviation": 0.7810000000000006, + "ionsChannel": [ + "NA" + ], + "ionsOutside": [] + }, + { + "id": "B.U2006-BC.U2006-BA.U2006-BB.U2006", + "nt1": "B.U2006", + "nt2": "BC.U2006", + "nt3": "BA.U2006", + "nt4": "BB.U2006", + "onz": "O-", + "gbaClassification": "VIIIa", + "planarityDeviation": 1.5840000000000005, + "ionsChannel": [ + "NA", + "NA" + ], + "ionsOutside": [] + } + ], + "onzm": "Op*", + "loopClassification": null, + "gbaClassification": [ + "VIII" + ], + "tracts": [ + [ + "B.G2002", + "B.G2003", + "B.G2004", + "B.G2005", + "B.U2006" + ], + [ + "BC.G2002", + "BC.G2003", + "BC.G2004", + "BC.G2005", + "BC.U2006" + ], + [ + "BA.G2002", + "BA.G2003", + "BA.G2004", + "BA.G2005", + "BA.U2006" + ], + [ + "BB.G2002", + "BB.G2003", + "BB.G2004", + "BB.G2005", + "BB.U2006" + ] + ], + "loops": [] + } + ], + "tetradPairs": [ + { + "tetrad1": "A.U1006-AC.U1006-AA.U1006-AB.U1006", + "tetrad2": "A.G1005-AC.G1005-AA.G1005-AB.G1005", + "direction": "parallel", + "rise": 3.366499999999995, + "twist": 39.962531742191736 + }, + { + "tetrad1": "A.G1005-AC.G1005-AA.G1005-AB.G1005", + "tetrad2": "A.G1004-AC.G1004-AA.G1004-AB.G1004", + "direction": "parallel", + "rise": 3.308000000000007, + "twist": 25.89614444631925 + }, + { + "tetrad1": "A.G1004-AC.G1004-AA.G1004-AB.G1004", + "tetrad2": "A.G1003-AC.G1003-AA.G1003-AB.G1003", + "direction": "parallel", + "rise": 3.339499999999994, + "twist": 35.81115298630443 + }, + { + "tetrad1": "A.G1003-AC.G1003-AA.G1003-AB.G1003", + "tetrad2": "A.G1002-AC.G1002-AA.G1002-AB.G1002", + "direction": "parallel", + "rise": 3.2865, + "twist": 27.11515971986803 + }, + { + "tetrad1": "A.G1002-AC.G1002-AA.G1002-AB.G1002", + "tetrad2": "B.G2002-BC.G2002-BA.G2002-BB.G2002", + "direction": "parallel", + "rise": 3.369500000000002, + "twist": 28.993180312675573 + }, + { + "tetrad1": "B.G2002-BC.G2002-BA.G2002-BB.G2002", + "tetrad2": "B.G2003-BC.G2003-BA.G2003-BB.G2003", + "direction": "parallel", + "rise": 3.371000000000002, + "twist": 27.410084968596852 + }, + { + "tetrad1": "B.G2003-BC.G2003-BA.G2003-BB.G2003", + "tetrad2": "B.G2004-BC.G2004-BA.G2004-BB.G2004", + "direction": "parallel", + "rise": 3.318000000000005, + "twist": 35.04072146975963 + }, + { + "tetrad1": "B.G2004-BC.G2004-BA.G2004-BB.G2004", + "tetrad2": "B.G2005-BC.G2005-BA.G2005-BB.G2005", + "direction": "parallel", + "rise": 3.2689999999999966, + "twist": 25.149997949938147 + }, + { + "tetrad1": "B.G2005-BC.G2005-BA.G2005-BB.G2005", + "tetrad2": "B.U2006-BC.U2006-BA.U2006-BB.U2006", + "direction": "parallel", + "rise": 7.140499999999998, + "twist": 43.40609492262336 + } + ] + } + ], + "dotBracket": { + "sequence": "UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU", + "line1": ".([{<A-.([{<A-.)]}>a-.)]}>a-.([{<A-.)]}>a-.([{<A-.)]}>a", + "line2": ".([{<A-.)]}>a-.([{<A-.)]}>a-.([{<A-.([{<A-.)]}>a-.)]}>a" + } +} +``` + +</details> + +# Funding + +This research was supported by the National Science Centre, Poland +\[2016/23/B/ST6/03931, 2019/35/B/ST6/03074\] and Mloda Kadra project +\[09/91/SBAD/0684\] from Poznan University of Technology, and carried +out in the European Centre for Bioinformatics and Genomics (Poland). The +authors also acknowledge partial support by the statutory funds of +Poznan University of Technology, Polish Ministry of Science and Higher +Education, and the Institute of Bioorganic Chemistry, PAS within +intramural financing program. + +# Bibliography + +<div id="refs" class="references csl-bib-body"> + +1. Topology-Based Classification of Tetrads and Quadruplex + Structures. M. Popenda, J. Miskiewicz, J. Sarzynska, T. Zok, M. + Szachniuk. *Bioinformatics*. 2020. 36(4):1129–1134. + doi:[10.1093/bioinformatics/btz738](https://doi.org/10.1093/bioinformatics/btz738) + +2. ElTetrado: A Tool for Identification and Classification of Tetrads + and Quadruplexes. T. Zok, M. Popenda, M. Szachniuk. *BMC + Bioinformatics*. 2020. 21(1):40. + doi:[10.1186/s12859-020-3385-1](https://doi.org/10.1186/s12859-020-3385-1) + +3. R-Chie : A Web Server and R Package for Visualizing RNA Secondary + Structures. D. Lai, J.R. Proctor, J.Y.A. Zhu, I.M. Meyer. *Nucleic + Acids Research*. 2012. 40(12):e95. + doi:[f99845](https://doi.org/f99845) + +4. Geometric Nomenclature and Classification of RNA Base Pairs. N.B. + Leontis, E. Westhof. *RNA*. 2001. 7(4):499–512. + doi:[10.1017/s1355838201002515](https://doi.org/10.1017/s1355838201002515) + +</div> + + +%prep +%autosetup -n eltetrado-1.5.15 + +%build +%py3_build + +%install +%py3_install +install -d -m755 %{buildroot}/%{_pkgdocdir} +if [ -d doc ]; then cp -arf doc %{buildroot}/%{_pkgdocdir}; fi +if [ -d docs ]; then cp -arf docs %{buildroot}/%{_pkgdocdir}; fi +if [ -d example ]; then cp -arf example %{buildroot}/%{_pkgdocdir}; fi +if [ -d examples ]; then cp -arf examples %{buildroot}/%{_pkgdocdir}; fi +pushd %{buildroot} +if [ -d usr/lib ]; then + find usr/lib -type f -printf "/%h/%f\n" >> filelist.lst +fi +if [ -d usr/lib64 ]; then + find usr/lib64 -type f -printf "/%h/%f\n" >> filelist.lst +fi +if [ -d usr/bin ]; then + find usr/bin -type f -printf "/%h/%f\n" >> filelist.lst +fi +if [ -d usr/sbin ]; then + find usr/sbin -type f -printf "/%h/%f\n" >> filelist.lst +fi +touch doclist.lst +if [ -d usr/share/man ]; then + find usr/share/man -type f -printf "/%h/%f.gz\n" >> doclist.lst +fi +popd +mv %{buildroot}/filelist.lst . +mv %{buildroot}/doclist.lst . + +%files -n python3-eltetrado -f filelist.lst +%dir %{python3_sitelib}/* + +%files help -f doclist.lst +%{_docdir}/* + +%changelog +* Mon May 29 2023 Python_Bot <Python_Bot@openeuler.org> - 1.5.15-1 +- Package Spec generated |
