From 5b0cdabca920e2e57ebb206eb0895d5dd465e826 Mon Sep 17 00:00:00 2001
From: CoprDistGit <infra@openeuler.org>
Date: Mon, 29 May 2023 12:47:59 +0000
Subject: automatic import of python-eltetrado

---
 .gitignore            |    1 +
 python-eltetrado.spec | 5896 +++++++++++++++++++++++++++++++++++++++++++++++++
 sources               |    1 +
 3 files changed, 5898 insertions(+)
 create mode 100644 python-eltetrado.spec
 create mode 100644 sources

diff --git a/.gitignore b/.gitignore
index e69de29..7b00e7c 100644
--- a/.gitignore
+++ b/.gitignore
@@ -0,0 +1 @@
+/eltetrado-1.5.15.tar.gz
diff --git a/python-eltetrado.spec b/python-eltetrado.spec
new file mode 100644
index 0000000..25ac544
--- /dev/null
+++ b/python-eltetrado.spec
@@ -0,0 +1,5896 @@
+%global _empty_manifest_terminate_build 0
+Name:		python-eltetrado
+Version:	1.5.15
+Release:	1
+Summary:	Find and classify tetrads and quadruplexes in DNA/RNA 3D structure
+License:	MIT License
+URL:		https://github.com/tzok/eltetrado
+Source0:	https://mirrors.nju.edu.cn/pypi/web/packages/63/a5/eade5c2ccfa45c110468f91e98191b35be42e29ae1c243db07e35d3717ce/eltetrado-1.5.15.tar.gz
+BuildArch:	noarch
+
+Requires:	python3-mmcif
+Requires:	python3-numpy
+Requires:	python3-orjson
+Requires:	python3-rnapolis
+
+%description
+![](logo.svg)
+
+# Project description
+
+This is an application to analyze base pairing patterns of DNA/RNA 3D
+structures to find and classify tetrads and quadruplexes. ElTetrado
+assigns tetrads to one of the ONZ classes (O, N, Z) alongside with the
+directionality of the tetrad (+/-) determined by the bonds between bases
+and their non-canonical interactions. The interactions follow
+Leontis/Westhof classification (Leontis *et al.* 2001). Watson-Crick (W)
+edge of first base in the tetrad structure exposed to the Hoogsteen (H)
+edge of the next nucleobase from the same tetrad sets the tetrad
+directionality, clockwise (+) or anticlockwise (-). For more details,
+please refer to Zok *et al.* (2020) and Popenda *et al.* (2020)
+
+# Installation
+
+Please run:
+
+    pip install eltetrado
+
+If you have both Python 2 and Python 3 installed, you need to explicitly
+call `pip3`:
+
+    pip3 install eltetrado
+
+# Dependencies
+
+The project is written in Python 3.6+ and requires
+[mmcif](https://pypi.org/project/mmcif/),
+[orjson](https://github.com/ijl/orjson), [NumPy](https://numpy.org/) and
+[requests](https://docs.python-requests.org/en/latest/).
+
+Visualization is created by `R` 3.6+ script which uses
+[R4RNA](https://www.e-rna.org/r-chie/) (Lai *et al.* 2012) library. The
+dependency will be automatically installed if not present.
+
+Base pairs and stacking interactions are identified by
+[RNApolis](https://github.com/tzok/rnapolis-py).
+
+# Usage
+
+ElTetrado is a command line application, which requires to be provided
+with `--input` and a path to a PDB or PDBx/mmCIF file.
+
+By default, ElTetrado outputs textual results on the standard output. A
+JSON version of the output can be obtained with `--output` switch
+followed by a path where the file is supposed to be created.
+
+ElTetrado prepares visualization of the whole structure and of each
+N4-helices, quadruplexes and tetrads. This can be supplemented with
+canonical base pairs visualization when `--complete-2d` is set. All
+color settings are located in the first several lines of the `quadraw.R`
+file, you can easily change them without knowledge of R language. If you
+want ElTetrado to not visualize anything, pass `--no-image` switch to
+it.
+
+    usage: eltetrado [-h] [-i INPUT] [-o OUTPUT] [-m MODEL]
+                     [--stacking-mismatch STACKING_MISMATCH] [--strict]
+                     [--no-reorder] [--complete-2d] [--no-image]
+                     [--dssr-json DSSR_JSON] [-v]
+
+    options:
+      -h, --help            show this help message and exit
+      -i INPUT, --input INPUT
+                            path to input PDB or PDBx/mmCIF file
+      -o OUTPUT, --output OUTPUT
+                            (optional) path for output JSON file
+      -m MODEL, --model MODEL
+                            (optional) model number to process
+      --stacking-mismatch STACKING_MISMATCH
+                            a perfect tetrad stacking covers 4 nucleotides; this
+                            option can be used with value 1 or 2 to allow this
+                            number of nucleotides to be non-stacked with otherwise
+                            well aligned tetrad [default=2]
+      --strict              nucleotides in tetrad are found when linked only by
+                            cWH pairing
+      --no-reorder          chains of bi- and tetramolecular quadruplexes should
+                            be reordered to be able to have them classified; when
+                            this is set, chains will be processed in original
+                            order, which for bi-/tetramolecular means that they
+                            will likely be misclassified; use with care!
+      --complete-2d         when set, the visualization will also show canonical
+                            base pairs to provide context for the quadruplex
+      --no-image            when set, the visualization will not be created at all
+      --dssr-json DSSR_JSON
+                            (optional) provide a JSON file generated by DSSR to
+                            read the secondary structure information from (use
+                            --nmr and --json switches)
+      -v, --version         show program's version number and exit
+
+# Chains reorder
+
+ElTetrado keeps a global and unique 5’-3’ index for every nucleotide
+which is independent from residue numbers. For example, if a structure
+has chain M with 60 nucleotides and chain N with 15 nucleotides, then
+ElTetrado will keep index between 0 and 74 which uniquely identifies
+every nucleotide. Initially, ElTetrado assigns this indices according to
+the order of chains in the input file. Therefore, if M preceded N then
+nucleotides in M will be indexed from 0 to 59 and in N from 60 to 74.
+Otherwise, nucleotides in N will be indexed from 0 to 14 and in M from
+15 to 74.
+
+When `--no-reorder` is present, this initial assignment is used.
+Otherwise, ElTetrado exhaustively checks all permutations of chains’
+orders. Every permutation check induces recalculation of the global and
+unique 5’-3’ index and in effect it changes ONZ classification of
+tetrads.
+
+ElTetrado keeps a table of tetrad classification scores according to
+these rules:
+
+- Type preference: `O` \> `N` \> `Z`
+- Direction preference: `+` \> `-`
+
+The table keeps low values for preferred classes i.e. `O+` is 0, `O-` is
+1 and so on up to `Z-` with score 5. For every permutation of chain
+orders, ElTetrado computes sum of scores for tetrads classification
+induced by 5’-3’ indexing. We select permutation with the minimum value.
+
+# Examples
+
+## 2HY9: Human telomere DNA quadruplex structure in K+ solution hybrid-1 form
+
+![](2hy9.png)
+
+    $ curl ftp://ftp.wwpdb.org/pub/pdb/data/structures/divided/mmCIF/my/2hy9.cif.gz | gzip -d > 2hy9.cif
+    $ ./eltetrado --input 2hy9.cif --output 2hy9.json
+
+    Chain order: 1
+    n4-helix with 3 tetrads
+      Oh* V,VI 9a -(pll) quadruplex with 3 tetrads
+        1.DG4 1.DG22 1.DG18 1.DG10 cWH cWH cWH cWH O- Vb planarity=0.17  
+          direction=hybrid rise=3.21 twist=16.23
+        1.DG5 1.DG23 1.DG17 1.DG11 cHW cHW cHW cHW O+ Va planarity=0.1  
+          direction=hybrid rise=3.11 twist=27.45
+        1.DG6 1.DG24 1.DG16 1.DG12 cHW cHW cHW cHW O+ VIa planarity=0.18  
+
+        Tracts:
+          1.DG4, 1.DG5, 1.DG6
+          1.DG22, 1.DG23, 1.DG24
+          1.DG18, 1.DG17, 1.DG16
+          1.DG10, 1.DG11, 1.DG12
+
+        Loops:
+          propeller- 1.DT7, 1.DT8, 1.DA9
+          lateral- 1.DT13, 1.DT14, 1.DA15
+          lateral+ 1.DT19, 1.DT20, 1.DA21
+
+    AAAGGGTTAGGGTTAGGGTTAGGGAA
+    ...([{...(((...)))...)]}..
+    ...([{...)]}...(((...)))..
+
+<details>
+<summary>
+Click to see the output JSON
+</summary>
+
+``` json
+{
+  "metals": [],
+  "nucleotides": [
+    {
+      "index": 1,
+      "chain": "1",
+      "number": 1,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DA1",
+      "shortName": "A",
+      "chi": 22.308282830857802,
+      "glycosidicBond": "syn"
+    },
+    {
+      "index": 2,
+      "chain": "1",
+      "number": 2,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DA2",
+      "shortName": "A",
+      "chi": -123.05454402191421,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 3,
+      "chain": "1",
+      "number": 3,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DA3",
+      "shortName": "A",
+      "chi": -94.96579955603106,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 4,
+      "chain": "1",
+      "number": 4,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DG4",
+      "shortName": "G",
+      "chi": 79.28363721639316,
+      "glycosidicBond": "syn"
+    },
+    {
+      "index": 5,
+      "chain": "1",
+      "number": 5,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DG5",
+      "shortName": "G",
+      "chi": -126.01709201555563,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 6,
+      "chain": "1",
+      "number": 6,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DG6",
+      "shortName": "G",
+      "chi": -127.26656202302102,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 7,
+      "chain": "1",
+      "number": 7,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DT7",
+      "shortName": "T",
+      "chi": -63.10830751967371,
+      "glycosidicBond": "syn"
+    },
+    {
+      "index": 8,
+      "chain": "1",
+      "number": 8,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DT8",
+      "shortName": "T",
+      "chi": -138.79520345559828,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 9,
+      "chain": "1",
+      "number": 9,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DA9",
+      "shortName": "A",
+      "chi": -148.83990757408878,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 10,
+      "chain": "1",
+      "number": 10,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DG10",
+      "shortName": "G",
+      "chi": 58.7787525019158,
+      "glycosidicBond": "syn"
+    },
+    {
+      "index": 11,
+      "chain": "1",
+      "number": 11,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DG11",
+      "shortName": "G",
+      "chi": -123.85746807924986,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 12,
+      "chain": "1",
+      "number": 12,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DG12",
+      "shortName": "G",
+      "chi": -84.36679807284759,
+      "glycosidicBond": "syn"
+    },
+    {
+      "index": 13,
+      "chain": "1",
+      "number": 13,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DT13",
+      "shortName": "T",
+      "chi": -30.819029132834157,
+      "glycosidicBond": "syn"
+    },
+    {
+      "index": 14,
+      "chain": "1",
+      "number": 14,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DT14",
+      "shortName": "T",
+      "chi": -168.51776782812965,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 15,
+      "chain": "1",
+      "number": 15,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DA15",
+      "shortName": "A",
+      "chi": -105.72881577106517,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 16,
+      "chain": "1",
+      "number": 16,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DG16",
+      "shortName": "G",
+      "chi": 74.3227942181243,
+      "glycosidicBond": "syn"
+    },
+    {
+      "index": 17,
+      "chain": "1",
+      "number": 17,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DG17",
+      "shortName": "G",
+      "chi": 81.08424926936044,
+      "glycosidicBond": "syn"
+    },
+    {
+      "index": 18,
+      "chain": "1",
+      "number": 18,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DG18",
+      "shortName": "G",
+      "chi": -122.90397217111551,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 19,
+      "chain": "1",
+      "number": 19,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DT19",
+      "shortName": "T",
+      "chi": -102.98239337113938,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 20,
+      "chain": "1",
+      "number": 20,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DT20",
+      "shortName": "T",
+      "chi": -112.1514601849715,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 21,
+      "chain": "1",
+      "number": 21,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DA21",
+      "shortName": "A",
+      "chi": -89.07113063649612,
+      "glycosidicBond": "syn"
+    },
+    {
+      "index": 22,
+      "chain": "1",
+      "number": 22,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DG22",
+      "shortName": "G",
+      "chi": 83.44318693001902,
+      "glycosidicBond": "syn"
+    },
+    {
+      "index": 23,
+      "chain": "1",
+      "number": 23,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DG23",
+      "shortName": "G",
+      "chi": -115.41210237198398,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 24,
+      "chain": "1",
+      "number": 24,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DG24",
+      "shortName": "G",
+      "chi": -111.14845782593531,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 25,
+      "chain": "1",
+      "number": 25,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DA25",
+      "shortName": "A",
+      "chi": -58.323530637551954,
+      "glycosidicBond": "syn"
+    },
+    {
+      "index": 26,
+      "chain": "1",
+      "number": 26,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DA26",
+      "shortName": "A",
+      "chi": -90.84065243137135,
+      "glycosidicBond": "anti"
+    }
+  ],
+  "basePairs": [
+    {
+      "nt1": "1.DA3",
+      "nt2": "1.DA21",
+      "lw": "cHW",
+      "inTetrad": false,
+      "canonical": false
+    },
+    {
+      "nt1": "1.DG4",
+      "nt2": "1.DG10",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "1.DG4",
+      "nt2": "1.DG22",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "1.DG5",
+      "nt2": "1.DG11",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "1.DG5",
+      "nt2": "1.DG23",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "1.DG6",
+      "nt2": "1.DG12",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "1.DG6",
+      "nt2": "1.DG24",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "1.DG10",
+      "nt2": "1.DG18",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "1.DG11",
+      "nt2": "1.DG17",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "1.DG12",
+      "nt2": "1.DG16",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "1.DT14",
+      "nt2": "1.DA25",
+      "lw": "tWW",
+      "inTetrad": false,
+      "canonical": false
+    },
+    {
+      "nt1": "1.DG16",
+      "nt2": "1.DG24",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "1.DG17",
+      "nt2": "1.DG23",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "1.DG18",
+      "nt2": "1.DG22",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    }
+  ],
+  "helices": [
+    {
+      "quadruplexes": [
+        {
+          "tetrads": [
+            {
+              "id": "1.DG4-1.DG22-1.DG18-1.DG10",
+              "nt1": "1.DG4",
+              "nt2": "1.DG22",
+              "nt3": "1.DG18",
+              "nt4": "1.DG10",
+              "onz": "O-",
+              "gbaClassification": "Vb",
+              "planarityDeviation": 0.17372283960377805,
+              "ionsChannel": [],
+              "ionsOutside": []
+            },
+            {
+              "id": "1.DG5-1.DG23-1.DG17-1.DG11",
+              "nt1": "1.DG5",
+              "nt2": "1.DG23",
+              "nt3": "1.DG17",
+              "nt4": "1.DG11",
+              "onz": "O+",
+              "gbaClassification": "Va",
+              "planarityDeviation": 0.10474313820007483,
+              "ionsChannel": [],
+              "ionsOutside": []
+            },
+            {
+              "id": "1.DG6-1.DG24-1.DG16-1.DG12",
+              "nt1": "1.DG6",
+              "nt2": "1.DG24",
+              "nt3": "1.DG16",
+              "nt4": "1.DG12",
+              "onz": "O+",
+              "gbaClassification": "VIa",
+              "planarityDeviation": 0.18293509778060615,
+              "ionsChannel": [],
+              "ionsOutside": []
+            }
+          ],
+          "onzm": "Oh*",
+          "loopClassification": {
+            "classification": "9a",
+            "loopProgression": "-(pll)"
+          },
+          "gbaClassification": [
+            "V",
+            "VI"
+          ],
+          "tracts": [
+            [
+              "1.DG4",
+              "1.DG5",
+              "1.DG6"
+            ],
+            [
+              "1.DG22",
+              "1.DG23",
+              "1.DG24"
+            ],
+            [
+              "1.DG18",
+              "1.DG17",
+              "1.DG16"
+            ],
+            [
+              "1.DG10",
+              "1.DG11",
+              "1.DG12"
+            ]
+          ],
+          "loops": [
+            {
+              "type": "propeller-",
+              "nucleotides": [
+                "1.DT7",
+                "1.DT8",
+                "1.DA9"
+              ]
+            },
+            {
+              "type": "lateral-",
+              "nucleotides": [
+                "1.DT13",
+                "1.DT14",
+                "1.DA15"
+              ]
+            },
+            {
+              "type": "lateral+",
+              "nucleotides": [
+                "1.DT19",
+                "1.DT20",
+                "1.DA21"
+              ]
+            }
+          ]
+        }
+      ],
+      "tetradPairs": [
+        {
+          "tetrad1": "1.DG4-1.DG22-1.DG18-1.DG10",
+          "tetrad2": "1.DG5-1.DG23-1.DG17-1.DG11",
+          "direction": "hybrid",
+          "rise": 3.2109650905140654,
+          "twist": 16.228973729066034
+        },
+        {
+          "tetrad1": "1.DG5-1.DG23-1.DG17-1.DG11",
+          "tetrad2": "1.DG6-1.DG24-1.DG16-1.DG12",
+          "direction": "hybrid",
+          "rise": 3.1149939255558747,
+          "twist": 27.448958336697046
+        }
+      ]
+    }
+  ],
+  "dotBracket": {
+    "sequence": "AAAGGGTTAGGGTTAGGGTTAGGGAA",
+    "line1": "...([{...(((...)))...)]}..",
+    "line2": "...([{...)]}...(((...))).."
+  }
+}
+```
+
+</details>
+
+## 4RJ1: Structural variations and solvent structure of UGGGGU quadruplexes stabilized by Sr2+ ions
+
+![](4rj1.png)
+
+    $ curl https://www.ebi.ac.uk/pdbe/static/entry/download/4rj1-assembly-1.cif.gz | gzip -d > 4rj1-1.cif
+    $ ./eltetrado --input 4rj1-1.cif --output 4rj1-1.json
+
+    Chain order: A AB AA AC B BC BA BB
+    n4-helix with 10 tetrads
+      Op* VIII n/a quadruplex with 5 tetrads
+        A.U1006 AC.U1006 AA.U1006 AB.U1006 cWH cWH cWH cWH O- VIIIa planarity=1.06 ions_channel=NA ions_outside=A.U1006: [SR] AA.U1006: [SR] AB.U1006: [SR] AC.U1006: [SR]
+          direction=parallel rise=3.37 twist=39.96
+        A.G1005 AC.G1005 AA.G1005 AB.G1005 cHW cHW cHW cHW O+ VIIIa planarity=0.8  
+          direction=parallel rise=3.31 twist=25.9
+        A.G1004 AC.G1004 AA.G1004 AB.G1004 cHW cHW cHW cHW O+ VIIIa planarity=0.41 ions_channel=SR 
+          direction=parallel rise=3.34 twist=35.81
+        A.G1003 AC.G1003 AA.G1003 AB.G1003 cHW cHW cHW cHW O+ VIIIa planarity=0.55 ions_channel=SR 
+          direction=parallel rise=3.29 twist=27.12
+        A.G1002 AC.G1002 AA.G1002 AB.G1002 cHW cHW cHW cHW O+ VIIIa planarity=0.54  ions_outside=AB.G1002: [CA] AC.G1002: [CA] AA.G1002: [CA] A.G1002: [CA]
+
+        Tracts:
+          A.U1006, A.G1005, A.G1004, A.G1003, A.G1002
+          AC.U1006, AC.G1005, AC.G1004, AC.G1003, AC.G1002
+          AA.U1006, AA.G1005, AA.G1004, AA.G1003, AA.G1002
+          AB.U1006, AB.G1005, AB.G1004, AB.G1003, AB.G1002
+
+      Op* VIII n/a quadruplex with 5 tetrads
+        B.G2002 BC.G2002 BA.G2002 BB.G2002 cWH cWH cWH cWH O+ VIIIa planarity=0.67  
+          direction=parallel rise=3.37 twist=27.41
+        B.G2003 BC.G2003 BA.G2003 BB.G2003 cWH cWH cWH cWH O+ VIIIa planarity=0.58 ions_channel=SR ions_outside=B.G2003: [CA] BA.G2003: [CA] BB.G2003: [CA] BC.G2003: [CA]
+          direction=parallel rise=3.32 twist=35.04
+        B.G2004 BC.G2004 BA.G2004 BB.G2004 cWH cWH cWH cWH O+ VIIIa planarity=0.23 ions_channel=SR 
+          direction=parallel rise=3.27 twist=25.15
+        B.G2005 BC.G2005 BA.G2005 BB.G2005 cWH cWH cWH cWH O+ VIIIa planarity=0.78 ions_channel=NA 
+          direction=parallel rise=7.14 twist=43.41
+        B.U2006 BC.U2006 BA.U2006 BB.U2006 cHW cHW cHW cHW O- VIIIa planarity=1.58 ions_channel=NA,NA 
+
+        Tracts:
+          B.G2002, B.G2003, B.G2004, B.G2005, B.U2006
+          BC.G2002, BC.G2003, BC.G2004, BC.G2005, BC.U2006
+          BA.G2002, BA.G2003, BA.G2004, BA.G2005, BA.U2006
+          BB.G2002, BB.G2003, BB.G2004, BB.G2005, BB.U2006
+
+    UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU
+    .([{<A-.([{<A-.)]}>a-.)]}>a-.([{<A-.)]}>a-.([{<A-.)]}>a
+    .([{<A-.)]}>a-.([{<A-.)]}>a-.([{<A-.([{<A-.)]}>a-.)]}>a
+
+<details>
+<summary>
+Click to see the output JSON
+</summary>
+
+``` json
+{
+  "metals": [
+    {
+      "symbol": "Sr",
+      "count": 8
+    },
+    {
+      "symbol": "Na",
+      "count": 4
+    },
+    {
+      "symbol": "Ca",
+      "count": 12
+    }
+  ],
+  "nucleotides": [
+    {
+      "index": 1,
+      "chain": "A",
+      "number": 1001,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "A.U1001",
+      "shortName": "U",
+      "chi": -141.92671313255752,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 2,
+      "chain": "A",
+      "number": 1002,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "A.G1002",
+      "shortName": "G",
+      "chi": -165.93034671112116,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 3,
+      "chain": "A",
+      "number": 1003,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "A.G1003",
+      "shortName": "G",
+      "chi": -121.5652426033226,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 4,
+      "chain": "A",
+      "number": 1004,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "A.G1004",
+      "shortName": "G",
+      "chi": -156.00957673923344,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 5,
+      "chain": "A",
+      "number": 1005,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "A.G1005",
+      "shortName": "G",
+      "chi": -148.10051684016415,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 6,
+      "chain": "A",
+      "number": 1006,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "A.U1006",
+      "shortName": "U",
+      "chi": -137.28005568139983,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 13,
+      "chain": "AA",
+      "number": 1001,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AA.U1001",
+      "shortName": "U",
+      "chi": -141.9267131325575,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 14,
+      "chain": "AA",
+      "number": 1002,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AA.G1002",
+      "shortName": "G",
+      "chi": -165.93034671112113,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 15,
+      "chain": "AA",
+      "number": 1003,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AA.G1003",
+      "shortName": "G",
+      "chi": -121.56524260332266,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 16,
+      "chain": "AA",
+      "number": 1004,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AA.G1004",
+      "shortName": "G",
+      "chi": -156.0095767392335,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 17,
+      "chain": "AA",
+      "number": 1005,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AA.G1005",
+      "shortName": "G",
+      "chi": -148.10051684016406,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 18,
+      "chain": "AA",
+      "number": 1006,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AA.U1006",
+      "shortName": "U",
+      "chi": -137.2800556813998,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 7,
+      "chain": "AB",
+      "number": 1001,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AB.U1001",
+      "shortName": "U",
+      "chi": -141.9267131325574,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 8,
+      "chain": "AB",
+      "number": 1002,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AB.G1002",
+      "shortName": "G",
+      "chi": -165.93034671112113,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 9,
+      "chain": "AB",
+      "number": 1003,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AB.G1003",
+      "shortName": "G",
+      "chi": -121.56524260332266,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 10,
+      "chain": "AB",
+      "number": 1004,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AB.G1004",
+      "shortName": "G",
+      "chi": -156.00957673923347,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 11,
+      "chain": "AB",
+      "number": 1005,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AB.G1005",
+      "shortName": "G",
+      "chi": -148.10051684016406,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 12,
+      "chain": "AB",
+      "number": 1006,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AB.U1006",
+      "shortName": "U",
+      "chi": -137.28005568139977,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 19,
+      "chain": "AC",
+      "number": 1001,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AC.U1001",
+      "shortName": "U",
+      "chi": -141.92671313255747,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 20,
+      "chain": "AC",
+      "number": 1002,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AC.G1002",
+      "shortName": "G",
+      "chi": -165.93034671112116,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 21,
+      "chain": "AC",
+      "number": 1003,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AC.G1003",
+      "shortName": "G",
+      "chi": -121.56524260332266,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 22,
+      "chain": "AC",
+      "number": 1004,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AC.G1004",
+      "shortName": "G",
+      "chi": -156.00957673923352,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 23,
+      "chain": "AC",
+      "number": 1005,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AC.G1005",
+      "shortName": "G",
+      "chi": -148.1005168401641,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 24,
+      "chain": "AC",
+      "number": 1006,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AC.U1006",
+      "shortName": "U",
+      "chi": -137.28005568139986,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 25,
+      "chain": "B",
+      "number": 2001,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "B.U2001",
+      "shortName": "U",
+      "chi": -146.4615316869476,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 26,
+      "chain": "B",
+      "number": 2002,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "B.G2002",
+      "shortName": "G",
+      "chi": -170.79660912745996,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 27,
+      "chain": "B",
+      "number": 2003,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "B.G2003",
+      "shortName": "G",
+      "chi": -117.68718110874113,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 28,
+      "chain": "B",
+      "number": 2004,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "B.G2004",
+      "shortName": "G",
+      "chi": -153.88587375071324,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 29,
+      "chain": "B",
+      "number": 2005,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "B.G2005",
+      "shortName": "G",
+      "chi": -148.8519912845669,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 30,
+      "chain": "B",
+      "number": 2006,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "B.U2006",
+      "shortName": "U",
+      "chi": -159.43730655241544,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 37,
+      "chain": "BA",
+      "number": 2001,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BA.U2001",
+      "shortName": "U",
+      "chi": -146.46153168694764,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 38,
+      "chain": "BA",
+      "number": 2002,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BA.G2002",
+      "shortName": "G",
+      "chi": -170.79660912745993,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 39,
+      "chain": "BA",
+      "number": 2003,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BA.G2003",
+      "shortName": "G",
+      "chi": -117.68718110874113,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 40,
+      "chain": "BA",
+      "number": 2004,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BA.G2004",
+      "shortName": "G",
+      "chi": -153.88587375071322,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 41,
+      "chain": "BA",
+      "number": 2005,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BA.G2005",
+      "shortName": "G",
+      "chi": -148.851991284567,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 42,
+      "chain": "BA",
+      "number": 2006,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BA.U2006",
+      "shortName": "U",
+      "chi": -159.43730655241544,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 43,
+      "chain": "BB",
+      "number": 2001,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BB.U2001",
+      "shortName": "U",
+      "chi": -146.4615316869476,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 44,
+      "chain": "BB",
+      "number": 2002,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BB.G2002",
+      "shortName": "G",
+      "chi": -170.79660912745993,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 45,
+      "chain": "BB",
+      "number": 2003,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BB.G2003",
+      "shortName": "G",
+      "chi": -117.68718110874106,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 46,
+      "chain": "BB",
+      "number": 2004,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BB.G2004",
+      "shortName": "G",
+      "chi": -153.8858737507132,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 47,
+      "chain": "BB",
+      "number": 2005,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BB.G2005",
+      "shortName": "G",
+      "chi": -148.85199128456696,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 48,
+      "chain": "BB",
+      "number": 2006,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BB.U2006",
+      "shortName": "U",
+      "chi": -159.43730655241544,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 31,
+      "chain": "BC",
+      "number": 2001,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BC.U2001",
+      "shortName": "U",
+      "chi": -146.4615316869476,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 32,
+      "chain": "BC",
+      "number": 2002,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BC.G2002",
+      "shortName": "G",
+      "chi": -170.79660912745993,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 33,
+      "chain": "BC",
+      "number": 2003,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BC.G2003",
+      "shortName": "G",
+      "chi": -117.68718110874121,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 34,
+      "chain": "BC",
+      "number": 2004,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BC.G2004",
+      "shortName": "G",
+      "chi": -153.88587375071322,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 35,
+      "chain": "BC",
+      "number": 2005,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BC.G2005",
+      "shortName": "G",
+      "chi": -148.85199128456694,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 36,
+      "chain": "BC",
+      "number": 2006,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BC.U2006",
+      "shortName": "U",
+      "chi": -159.43730655241544,
+      "glycosidicBond": "anti"
+    }
+  ],
+  "basePairs": [
+    {
+      "nt1": "A.G1002",
+      "nt2": "AB.G1002",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "A.G1002",
+      "nt2": "AC.G1002",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "A.G1003",
+      "nt2": "AB.G1003",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "A.G1003",
+      "nt2": "AC.G1003",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "A.G1004",
+      "nt2": "AB.G1004",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "A.G1004",
+      "nt2": "AC.G1004",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "A.G1005",
+      "nt2": "AB.G1005",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "A.G1005",
+      "nt2": "AC.G1005",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "A.U1006",
+      "nt2": "AB.U1006",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "A.U1006",
+      "nt2": "AC.U1006",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "AB.G1002",
+      "nt2": "AA.G1002",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "AA.G1002",
+      "nt2": "AC.G1002",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "AB.G1003",
+      "nt2": "AA.G1003",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "AA.G1003",
+      "nt2": "AC.G1003",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "AB.G1004",
+      "nt2": "AA.G1004",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "AA.G1004",
+      "nt2": "AC.G1004",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "AB.G1005",
+      "nt2": "AA.G1005",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "AA.G1005",
+      "nt2": "AC.G1005",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "AB.U1006",
+      "nt2": "AA.U1006",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "AA.U1006",
+      "nt2": "AC.U1006",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "B.G2002",
+      "nt2": "BB.G2002",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "B.G2002",
+      "nt2": "BC.G2002",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "B.G2003",
+      "nt2": "BB.G2003",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "B.G2003",
+      "nt2": "BC.G2003",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "B.G2004",
+      "nt2": "BB.G2004",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "B.G2004",
+      "nt2": "BC.G2004",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "B.G2005",
+      "nt2": "BB.G2005",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "B.G2005",
+      "nt2": "BC.G2005",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "B.U2006",
+      "nt2": "BB.U2006",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "B.U2006",
+      "nt2": "BC.U2006",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "BA.G2002",
+      "nt2": "BB.G2002",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "BC.G2002",
+      "nt2": "BA.G2002",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "BA.G2003",
+      "nt2": "BB.G2003",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "BC.G2003",
+      "nt2": "BA.G2003",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "BA.G2004",
+      "nt2": "BB.G2004",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "BC.G2004",
+      "nt2": "BA.G2004",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "BA.G2005",
+      "nt2": "BB.G2005",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "BC.G2005",
+      "nt2": "BA.G2005",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "BA.U2006",
+      "nt2": "BB.U2006",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "BC.U2006",
+      "nt2": "BA.U2006",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    }
+  ],
+  "helices": [
+    {
+      "quadruplexes": [
+        {
+          "tetrads": [
+            {
+              "id": "A.U1006-AC.U1006-AA.U1006-AB.U1006",
+              "nt1": "A.U1006",
+              "nt2": "AC.U1006",
+              "nt3": "AA.U1006",
+              "nt4": "AB.U1006",
+              "onz": "O-",
+              "gbaClassification": "VIIIa",
+              "planarityDeviation": 1.061,
+              "ionsChannel": [
+                "NA"
+              ],
+              "ionsOutside": [
+                {
+                  "nt": "A.U1006",
+                  "ion": "SR"
+                },
+                {
+                  "nt": "AA.U1006",
+                  "ion": "SR"
+                },
+                {
+                  "nt": "AB.U1006",
+                  "ion": "SR"
+                },
+                {
+                  "nt": "AC.U1006",
+                  "ion": "SR"
+                }
+              ]
+            },
+            {
+              "id": "A.G1005-AC.G1005-AA.G1005-AB.G1005",
+              "nt1": "A.G1005",
+              "nt2": "AC.G1005",
+              "nt3": "AA.G1005",
+              "nt4": "AB.G1005",
+              "onz": "O+",
+              "gbaClassification": "VIIIa",
+              "planarityDeviation": 0.7999999999999972,
+              "ionsChannel": [],
+              "ionsOutside": []
+            },
+            {
+              "id": "A.G1004-AC.G1004-AA.G1004-AB.G1004",
+              "nt1": "A.G1004",
+              "nt2": "AC.G1004",
+              "nt3": "AA.G1004",
+              "nt4": "AB.G1004",
+              "onz": "O+",
+              "gbaClassification": "VIIIa",
+              "planarityDeviation": 0.4059999999999988,
+              "ionsChannel": [
+                "SR"
+              ],
+              "ionsOutside": []
+            },
+            {
+              "id": "A.G1003-AC.G1003-AA.G1003-AB.G1003",
+              "nt1": "A.G1003",
+              "nt2": "AC.G1003",
+              "nt3": "AA.G1003",
+              "nt4": "AB.G1003",
+              "onz": "O+",
+              "gbaClassification": "VIIIa",
+              "planarityDeviation": 0.5549999999999997,
+              "ionsChannel": [
+                "SR"
+              ],
+              "ionsOutside": []
+            },
+            {
+              "id": "A.G1002-AC.G1002-AA.G1002-AB.G1002",
+              "nt1": "A.G1002",
+              "nt2": "AC.G1002",
+              "nt3": "AA.G1002",
+              "nt4": "AB.G1002",
+              "onz": "O+",
+              "gbaClassification": "VIIIa",
+              "planarityDeviation": 0.541999999999998,
+              "ionsChannel": [],
+              "ionsOutside": [
+                {
+                  "nt": "AB.G1002",
+                  "ion": "CA"
+                },
+                {
+                  "nt": "AC.G1002",
+                  "ion": "CA"
+                },
+                {
+                  "nt": "AA.G1002",
+                  "ion": "CA"
+                },
+                {
+                  "nt": "A.G1002",
+                  "ion": "CA"
+                }
+              ]
+            }
+          ],
+          "onzm": "Op*",
+          "loopClassification": null,
+          "gbaClassification": [
+            "VIII"
+          ],
+          "tracts": [
+            [
+              "A.U1006",
+              "A.G1005",
+              "A.G1004",
+              "A.G1003",
+              "A.G1002"
+            ],
+            [
+              "AC.U1006",
+              "AC.G1005",
+              "AC.G1004",
+              "AC.G1003",
+              "AC.G1002"
+            ],
+            [
+              "AA.U1006",
+              "AA.G1005",
+              "AA.G1004",
+              "AA.G1003",
+              "AA.G1002"
+            ],
+            [
+              "AB.U1006",
+              "AB.G1005",
+              "AB.G1004",
+              "AB.G1003",
+              "AB.G1002"
+            ]
+          ],
+          "loops": []
+        },
+        {
+          "tetrads": [
+            {
+              "id": "B.G2002-BC.G2002-BA.G2002-BB.G2002",
+              "nt1": "B.G2002",
+              "nt2": "BC.G2002",
+              "nt3": "BA.G2002",
+              "nt4": "BB.G2002",
+              "onz": "O+",
+              "gbaClassification": "VIIIa",
+              "planarityDeviation": 0.6730000000000018,
+              "ionsChannel": [],
+              "ionsOutside": []
+            },
+            {
+              "id": "B.G2003-BC.G2003-BA.G2003-BB.G2003",
+              "nt1": "B.G2003",
+              "nt2": "BC.G2003",
+              "nt3": "BA.G2003",
+              "nt4": "BB.G2003",
+              "onz": "O+",
+              "gbaClassification": "VIIIa",
+              "planarityDeviation": 0.5769999999999982,
+              "ionsChannel": [
+                "SR"
+              ],
+              "ionsOutside": [
+                {
+                  "nt": "B.G2003",
+                  "ion": "CA"
+                },
+                {
+                  "nt": "BA.G2003",
+                  "ion": "CA"
+                },
+                {
+                  "nt": "BB.G2003",
+                  "ion": "CA"
+                },
+                {
+                  "nt": "BC.G2003",
+                  "ion": "CA"
+                }
+              ]
+            },
+            {
+              "id": "B.G2004-BC.G2004-BA.G2004-BB.G2004",
+              "nt1": "B.G2004",
+              "nt2": "BC.G2004",
+              "nt3": "BA.G2004",
+              "nt4": "BB.G2004",
+              "onz": "O+",
+              "gbaClassification": "VIIIa",
+              "planarityDeviation": 0.2289999999999992,
+              "ionsChannel": [
+                "SR"
+              ],
+              "ionsOutside": []
+            },
+            {
+              "id": "B.G2005-BC.G2005-BA.G2005-BB.G2005",
+              "nt1": "B.G2005",
+              "nt2": "BC.G2005",
+              "nt3": "BA.G2005",
+              "nt4": "BB.G2005",
+              "onz": "O+",
+              "gbaClassification": "VIIIa",
+              "planarityDeviation": 0.7810000000000006,
+              "ionsChannel": [
+                "NA"
+              ],
+              "ionsOutside": []
+            },
+            {
+              "id": "B.U2006-BC.U2006-BA.U2006-BB.U2006",
+              "nt1": "B.U2006",
+              "nt2": "BC.U2006",
+              "nt3": "BA.U2006",
+              "nt4": "BB.U2006",
+              "onz": "O-",
+              "gbaClassification": "VIIIa",
+              "planarityDeviation": 1.5840000000000005,
+              "ionsChannel": [
+                "NA",
+                "NA"
+              ],
+              "ionsOutside": []
+            }
+          ],
+          "onzm": "Op*",
+          "loopClassification": null,
+          "gbaClassification": [
+            "VIII"
+          ],
+          "tracts": [
+            [
+              "B.G2002",
+              "B.G2003",
+              "B.G2004",
+              "B.G2005",
+              "B.U2006"
+            ],
+            [
+              "BC.G2002",
+              "BC.G2003",
+              "BC.G2004",
+              "BC.G2005",
+              "BC.U2006"
+            ],
+            [
+              "BA.G2002",
+              "BA.G2003",
+              "BA.G2004",
+              "BA.G2005",
+              "BA.U2006"
+            ],
+            [
+              "BB.G2002",
+              "BB.G2003",
+              "BB.G2004",
+              "BB.G2005",
+              "BB.U2006"
+            ]
+          ],
+          "loops": []
+        }
+      ],
+      "tetradPairs": [
+        {
+          "tetrad1": "A.U1006-AC.U1006-AA.U1006-AB.U1006",
+          "tetrad2": "A.G1005-AC.G1005-AA.G1005-AB.G1005",
+          "direction": "parallel",
+          "rise": 3.366499999999995,
+          "twist": 39.962531742191736
+        },
+        {
+          "tetrad1": "A.G1005-AC.G1005-AA.G1005-AB.G1005",
+          "tetrad2": "A.G1004-AC.G1004-AA.G1004-AB.G1004",
+          "direction": "parallel",
+          "rise": 3.308000000000007,
+          "twist": 25.89614444631925
+        },
+        {
+          "tetrad1": "A.G1004-AC.G1004-AA.G1004-AB.G1004",
+          "tetrad2": "A.G1003-AC.G1003-AA.G1003-AB.G1003",
+          "direction": "parallel",
+          "rise": 3.339499999999994,
+          "twist": 35.81115298630443
+        },
+        {
+          "tetrad1": "A.G1003-AC.G1003-AA.G1003-AB.G1003",
+          "tetrad2": "A.G1002-AC.G1002-AA.G1002-AB.G1002",
+          "direction": "parallel",
+          "rise": 3.2865,
+          "twist": 27.11515971986803
+        },
+        {
+          "tetrad1": "A.G1002-AC.G1002-AA.G1002-AB.G1002",
+          "tetrad2": "B.G2002-BC.G2002-BA.G2002-BB.G2002",
+          "direction": "parallel",
+          "rise": 3.369500000000002,
+          "twist": 28.993180312675573
+        },
+        {
+          "tetrad1": "B.G2002-BC.G2002-BA.G2002-BB.G2002",
+          "tetrad2": "B.G2003-BC.G2003-BA.G2003-BB.G2003",
+          "direction": "parallel",
+          "rise": 3.371000000000002,
+          "twist": 27.410084968596852
+        },
+        {
+          "tetrad1": "B.G2003-BC.G2003-BA.G2003-BB.G2003",
+          "tetrad2": "B.G2004-BC.G2004-BA.G2004-BB.G2004",
+          "direction": "parallel",
+          "rise": 3.318000000000005,
+          "twist": 35.04072146975963
+        },
+        {
+          "tetrad1": "B.G2004-BC.G2004-BA.G2004-BB.G2004",
+          "tetrad2": "B.G2005-BC.G2005-BA.G2005-BB.G2005",
+          "direction": "parallel",
+          "rise": 3.2689999999999966,
+          "twist": 25.149997949938147
+        },
+        {
+          "tetrad1": "B.G2005-BC.G2005-BA.G2005-BB.G2005",
+          "tetrad2": "B.U2006-BC.U2006-BA.U2006-BB.U2006",
+          "direction": "parallel",
+          "rise": 7.140499999999998,
+          "twist": 43.40609492262336
+        }
+      ]
+    }
+  ],
+  "dotBracket": {
+    "sequence": "UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU",
+    "line1": ".([{<A-.([{<A-.)]}>a-.)]}>a-.([{<A-.)]}>a-.([{<A-.)]}>a",
+    "line2": ".([{<A-.)]}>a-.([{<A-.)]}>a-.([{<A-.([{<A-.)]}>a-.)]}>a"
+  }
+}
+```
+
+</details>
+
+# Funding
+
+This research was supported by the National Science Centre, Poland
+\[2016/23/B/ST6/03931, 2019/35/B/ST6/03074\] and Mloda Kadra project
+\[09/91/SBAD/0684\] from Poznan University of Technology, and carried
+out in the European Centre for Bioinformatics and Genomics (Poland). The
+authors also acknowledge partial support by the statutory funds of
+Poznan University of Technology, Polish Ministry of Science and Higher
+Education, and the Institute of Bioorganic Chemistry, PAS within
+intramural financing program.
+
+# Bibliography
+
+<div id="refs" class="references csl-bib-body">
+
+1.  Topology-Based Classification of Tetrads and Quadruplex
+    Structures. M. Popenda, J. Miskiewicz, J. Sarzynska, T. Zok, M.
+    Szachniuk. *Bioinformatics*. 2020. 36(4):1129–1134.
+    doi:[10.1093/bioinformatics/btz738](https://doi.org/10.1093/bioinformatics/btz738)
+
+2.  ElTetrado: A Tool for Identification and Classification of Tetrads
+    and Quadruplexes. T. Zok, M. Popenda, M. Szachniuk. *BMC
+    Bioinformatics*. 2020. 21(1):40.
+    doi:[10.1186/s12859-020-3385-1](https://doi.org/10.1186/s12859-020-3385-1)
+
+3.  R-Chie : A Web Server and R Package for Visualizing RNA Secondary
+    Structures. D. Lai, J.R. Proctor, J.Y.A. Zhu, I.M. Meyer. *Nucleic
+    Acids Research*. 2012. 40(12):e95.
+    doi:[f99845](https://doi.org/f99845)
+
+4.  Geometric Nomenclature and Classification of RNA Base Pairs. N.B.
+    Leontis, E. Westhof. *RNA*. 2001. 7(4):499–512.
+    doi:[10.1017/s1355838201002515](https://doi.org/10.1017/s1355838201002515)
+
+</div>
+
+
+%package -n python3-eltetrado
+Summary:	Find and classify tetrads and quadruplexes in DNA/RNA 3D structure
+Provides:	python-eltetrado
+BuildRequires:	python3-devel
+BuildRequires:	python3-setuptools
+BuildRequires:	python3-pip
+%description -n python3-eltetrado
+![](logo.svg)
+
+# Project description
+
+This is an application to analyze base pairing patterns of DNA/RNA 3D
+structures to find and classify tetrads and quadruplexes. ElTetrado
+assigns tetrads to one of the ONZ classes (O, N, Z) alongside with the
+directionality of the tetrad (+/-) determined by the bonds between bases
+and their non-canonical interactions. The interactions follow
+Leontis/Westhof classification (Leontis *et al.* 2001). Watson-Crick (W)
+edge of first base in the tetrad structure exposed to the Hoogsteen (H)
+edge of the next nucleobase from the same tetrad sets the tetrad
+directionality, clockwise (+) or anticlockwise (-). For more details,
+please refer to Zok *et al.* (2020) and Popenda *et al.* (2020)
+
+# Installation
+
+Please run:
+
+    pip install eltetrado
+
+If you have both Python 2 and Python 3 installed, you need to explicitly
+call `pip3`:
+
+    pip3 install eltetrado
+
+# Dependencies
+
+The project is written in Python 3.6+ and requires
+[mmcif](https://pypi.org/project/mmcif/),
+[orjson](https://github.com/ijl/orjson), [NumPy](https://numpy.org/) and
+[requests](https://docs.python-requests.org/en/latest/).
+
+Visualization is created by `R` 3.6+ script which uses
+[R4RNA](https://www.e-rna.org/r-chie/) (Lai *et al.* 2012) library. The
+dependency will be automatically installed if not present.
+
+Base pairs and stacking interactions are identified by
+[RNApolis](https://github.com/tzok/rnapolis-py).
+
+# Usage
+
+ElTetrado is a command line application, which requires to be provided
+with `--input` and a path to a PDB or PDBx/mmCIF file.
+
+By default, ElTetrado outputs textual results on the standard output. A
+JSON version of the output can be obtained with `--output` switch
+followed by a path where the file is supposed to be created.
+
+ElTetrado prepares visualization of the whole structure and of each
+N4-helices, quadruplexes and tetrads. This can be supplemented with
+canonical base pairs visualization when `--complete-2d` is set. All
+color settings are located in the first several lines of the `quadraw.R`
+file, you can easily change them without knowledge of R language. If you
+want ElTetrado to not visualize anything, pass `--no-image` switch to
+it.
+
+    usage: eltetrado [-h] [-i INPUT] [-o OUTPUT] [-m MODEL]
+                     [--stacking-mismatch STACKING_MISMATCH] [--strict]
+                     [--no-reorder] [--complete-2d] [--no-image]
+                     [--dssr-json DSSR_JSON] [-v]
+
+    options:
+      -h, --help            show this help message and exit
+      -i INPUT, --input INPUT
+                            path to input PDB or PDBx/mmCIF file
+      -o OUTPUT, --output OUTPUT
+                            (optional) path for output JSON file
+      -m MODEL, --model MODEL
+                            (optional) model number to process
+      --stacking-mismatch STACKING_MISMATCH
+                            a perfect tetrad stacking covers 4 nucleotides; this
+                            option can be used with value 1 or 2 to allow this
+                            number of nucleotides to be non-stacked with otherwise
+                            well aligned tetrad [default=2]
+      --strict              nucleotides in tetrad are found when linked only by
+                            cWH pairing
+      --no-reorder          chains of bi- and tetramolecular quadruplexes should
+                            be reordered to be able to have them classified; when
+                            this is set, chains will be processed in original
+                            order, which for bi-/tetramolecular means that they
+                            will likely be misclassified; use with care!
+      --complete-2d         when set, the visualization will also show canonical
+                            base pairs to provide context for the quadruplex
+      --no-image            when set, the visualization will not be created at all
+      --dssr-json DSSR_JSON
+                            (optional) provide a JSON file generated by DSSR to
+                            read the secondary structure information from (use
+                            --nmr and --json switches)
+      -v, --version         show program's version number and exit
+
+# Chains reorder
+
+ElTetrado keeps a global and unique 5’-3’ index for every nucleotide
+which is independent from residue numbers. For example, if a structure
+has chain M with 60 nucleotides and chain N with 15 nucleotides, then
+ElTetrado will keep index between 0 and 74 which uniquely identifies
+every nucleotide. Initially, ElTetrado assigns this indices according to
+the order of chains in the input file. Therefore, if M preceded N then
+nucleotides in M will be indexed from 0 to 59 and in N from 60 to 74.
+Otherwise, nucleotides in N will be indexed from 0 to 14 and in M from
+15 to 74.
+
+When `--no-reorder` is present, this initial assignment is used.
+Otherwise, ElTetrado exhaustively checks all permutations of chains’
+orders. Every permutation check induces recalculation of the global and
+unique 5’-3’ index and in effect it changes ONZ classification of
+tetrads.
+
+ElTetrado keeps a table of tetrad classification scores according to
+these rules:
+
+- Type preference: `O` \> `N` \> `Z`
+- Direction preference: `+` \> `-`
+
+The table keeps low values for preferred classes i.e. `O+` is 0, `O-` is
+1 and so on up to `Z-` with score 5. For every permutation of chain
+orders, ElTetrado computes sum of scores for tetrads classification
+induced by 5’-3’ indexing. We select permutation with the minimum value.
+
+# Examples
+
+## 2HY9: Human telomere DNA quadruplex structure in K+ solution hybrid-1 form
+
+![](2hy9.png)
+
+    $ curl ftp://ftp.wwpdb.org/pub/pdb/data/structures/divided/mmCIF/my/2hy9.cif.gz | gzip -d > 2hy9.cif
+    $ ./eltetrado --input 2hy9.cif --output 2hy9.json
+
+    Chain order: 1
+    n4-helix with 3 tetrads
+      Oh* V,VI 9a -(pll) quadruplex with 3 tetrads
+        1.DG4 1.DG22 1.DG18 1.DG10 cWH cWH cWH cWH O- Vb planarity=0.17  
+          direction=hybrid rise=3.21 twist=16.23
+        1.DG5 1.DG23 1.DG17 1.DG11 cHW cHW cHW cHW O+ Va planarity=0.1  
+          direction=hybrid rise=3.11 twist=27.45
+        1.DG6 1.DG24 1.DG16 1.DG12 cHW cHW cHW cHW O+ VIa planarity=0.18  
+
+        Tracts:
+          1.DG4, 1.DG5, 1.DG6
+          1.DG22, 1.DG23, 1.DG24
+          1.DG18, 1.DG17, 1.DG16
+          1.DG10, 1.DG11, 1.DG12
+
+        Loops:
+          propeller- 1.DT7, 1.DT8, 1.DA9
+          lateral- 1.DT13, 1.DT14, 1.DA15
+          lateral+ 1.DT19, 1.DT20, 1.DA21
+
+    AAAGGGTTAGGGTTAGGGTTAGGGAA
+    ...([{...(((...)))...)]}..
+    ...([{...)]}...(((...)))..
+
+<details>
+<summary>
+Click to see the output JSON
+</summary>
+
+``` json
+{
+  "metals": [],
+  "nucleotides": [
+    {
+      "index": 1,
+      "chain": "1",
+      "number": 1,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DA1",
+      "shortName": "A",
+      "chi": 22.308282830857802,
+      "glycosidicBond": "syn"
+    },
+    {
+      "index": 2,
+      "chain": "1",
+      "number": 2,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DA2",
+      "shortName": "A",
+      "chi": -123.05454402191421,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 3,
+      "chain": "1",
+      "number": 3,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DA3",
+      "shortName": "A",
+      "chi": -94.96579955603106,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 4,
+      "chain": "1",
+      "number": 4,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DG4",
+      "shortName": "G",
+      "chi": 79.28363721639316,
+      "glycosidicBond": "syn"
+    },
+    {
+      "index": 5,
+      "chain": "1",
+      "number": 5,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DG5",
+      "shortName": "G",
+      "chi": -126.01709201555563,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 6,
+      "chain": "1",
+      "number": 6,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DG6",
+      "shortName": "G",
+      "chi": -127.26656202302102,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 7,
+      "chain": "1",
+      "number": 7,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DT7",
+      "shortName": "T",
+      "chi": -63.10830751967371,
+      "glycosidicBond": "syn"
+    },
+    {
+      "index": 8,
+      "chain": "1",
+      "number": 8,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DT8",
+      "shortName": "T",
+      "chi": -138.79520345559828,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 9,
+      "chain": "1",
+      "number": 9,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DA9",
+      "shortName": "A",
+      "chi": -148.83990757408878,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 10,
+      "chain": "1",
+      "number": 10,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DG10",
+      "shortName": "G",
+      "chi": 58.7787525019158,
+      "glycosidicBond": "syn"
+    },
+    {
+      "index": 11,
+      "chain": "1",
+      "number": 11,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DG11",
+      "shortName": "G",
+      "chi": -123.85746807924986,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 12,
+      "chain": "1",
+      "number": 12,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DG12",
+      "shortName": "G",
+      "chi": -84.36679807284759,
+      "glycosidicBond": "syn"
+    },
+    {
+      "index": 13,
+      "chain": "1",
+      "number": 13,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DT13",
+      "shortName": "T",
+      "chi": -30.819029132834157,
+      "glycosidicBond": "syn"
+    },
+    {
+      "index": 14,
+      "chain": "1",
+      "number": 14,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DT14",
+      "shortName": "T",
+      "chi": -168.51776782812965,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 15,
+      "chain": "1",
+      "number": 15,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DA15",
+      "shortName": "A",
+      "chi": -105.72881577106517,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 16,
+      "chain": "1",
+      "number": 16,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DG16",
+      "shortName": "G",
+      "chi": 74.3227942181243,
+      "glycosidicBond": "syn"
+    },
+    {
+      "index": 17,
+      "chain": "1",
+      "number": 17,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DG17",
+      "shortName": "G",
+      "chi": 81.08424926936044,
+      "glycosidicBond": "syn"
+    },
+    {
+      "index": 18,
+      "chain": "1",
+      "number": 18,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DG18",
+      "shortName": "G",
+      "chi": -122.90397217111551,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 19,
+      "chain": "1",
+      "number": 19,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DT19",
+      "shortName": "T",
+      "chi": -102.98239337113938,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 20,
+      "chain": "1",
+      "number": 20,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DT20",
+      "shortName": "T",
+      "chi": -112.1514601849715,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 21,
+      "chain": "1",
+      "number": 21,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DA21",
+      "shortName": "A",
+      "chi": -89.07113063649612,
+      "glycosidicBond": "syn"
+    },
+    {
+      "index": 22,
+      "chain": "1",
+      "number": 22,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DG22",
+      "shortName": "G",
+      "chi": 83.44318693001902,
+      "glycosidicBond": "syn"
+    },
+    {
+      "index": 23,
+      "chain": "1",
+      "number": 23,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DG23",
+      "shortName": "G",
+      "chi": -115.41210237198398,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 24,
+      "chain": "1",
+      "number": 24,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DG24",
+      "shortName": "G",
+      "chi": -111.14845782593531,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 25,
+      "chain": "1",
+      "number": 25,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DA25",
+      "shortName": "A",
+      "chi": -58.323530637551954,
+      "glycosidicBond": "syn"
+    },
+    {
+      "index": 26,
+      "chain": "1",
+      "number": 26,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DA26",
+      "shortName": "A",
+      "chi": -90.84065243137135,
+      "glycosidicBond": "anti"
+    }
+  ],
+  "basePairs": [
+    {
+      "nt1": "1.DA3",
+      "nt2": "1.DA21",
+      "lw": "cHW",
+      "inTetrad": false,
+      "canonical": false
+    },
+    {
+      "nt1": "1.DG4",
+      "nt2": "1.DG10",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "1.DG4",
+      "nt2": "1.DG22",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "1.DG5",
+      "nt2": "1.DG11",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "1.DG5",
+      "nt2": "1.DG23",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "1.DG6",
+      "nt2": "1.DG12",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "1.DG6",
+      "nt2": "1.DG24",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "1.DG10",
+      "nt2": "1.DG18",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "1.DG11",
+      "nt2": "1.DG17",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "1.DG12",
+      "nt2": "1.DG16",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "1.DT14",
+      "nt2": "1.DA25",
+      "lw": "tWW",
+      "inTetrad": false,
+      "canonical": false
+    },
+    {
+      "nt1": "1.DG16",
+      "nt2": "1.DG24",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "1.DG17",
+      "nt2": "1.DG23",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "1.DG18",
+      "nt2": "1.DG22",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    }
+  ],
+  "helices": [
+    {
+      "quadruplexes": [
+        {
+          "tetrads": [
+            {
+              "id": "1.DG4-1.DG22-1.DG18-1.DG10",
+              "nt1": "1.DG4",
+              "nt2": "1.DG22",
+              "nt3": "1.DG18",
+              "nt4": "1.DG10",
+              "onz": "O-",
+              "gbaClassification": "Vb",
+              "planarityDeviation": 0.17372283960377805,
+              "ionsChannel": [],
+              "ionsOutside": []
+            },
+            {
+              "id": "1.DG5-1.DG23-1.DG17-1.DG11",
+              "nt1": "1.DG5",
+              "nt2": "1.DG23",
+              "nt3": "1.DG17",
+              "nt4": "1.DG11",
+              "onz": "O+",
+              "gbaClassification": "Va",
+              "planarityDeviation": 0.10474313820007483,
+              "ionsChannel": [],
+              "ionsOutside": []
+            },
+            {
+              "id": "1.DG6-1.DG24-1.DG16-1.DG12",
+              "nt1": "1.DG6",
+              "nt2": "1.DG24",
+              "nt3": "1.DG16",
+              "nt4": "1.DG12",
+              "onz": "O+",
+              "gbaClassification": "VIa",
+              "planarityDeviation": 0.18293509778060615,
+              "ionsChannel": [],
+              "ionsOutside": []
+            }
+          ],
+          "onzm": "Oh*",
+          "loopClassification": {
+            "classification": "9a",
+            "loopProgression": "-(pll)"
+          },
+          "gbaClassification": [
+            "V",
+            "VI"
+          ],
+          "tracts": [
+            [
+              "1.DG4",
+              "1.DG5",
+              "1.DG6"
+            ],
+            [
+              "1.DG22",
+              "1.DG23",
+              "1.DG24"
+            ],
+            [
+              "1.DG18",
+              "1.DG17",
+              "1.DG16"
+            ],
+            [
+              "1.DG10",
+              "1.DG11",
+              "1.DG12"
+            ]
+          ],
+          "loops": [
+            {
+              "type": "propeller-",
+              "nucleotides": [
+                "1.DT7",
+                "1.DT8",
+                "1.DA9"
+              ]
+            },
+            {
+              "type": "lateral-",
+              "nucleotides": [
+                "1.DT13",
+                "1.DT14",
+                "1.DA15"
+              ]
+            },
+            {
+              "type": "lateral+",
+              "nucleotides": [
+                "1.DT19",
+                "1.DT20",
+                "1.DA21"
+              ]
+            }
+          ]
+        }
+      ],
+      "tetradPairs": [
+        {
+          "tetrad1": "1.DG4-1.DG22-1.DG18-1.DG10",
+          "tetrad2": "1.DG5-1.DG23-1.DG17-1.DG11",
+          "direction": "hybrid",
+          "rise": 3.2109650905140654,
+          "twist": 16.228973729066034
+        },
+        {
+          "tetrad1": "1.DG5-1.DG23-1.DG17-1.DG11",
+          "tetrad2": "1.DG6-1.DG24-1.DG16-1.DG12",
+          "direction": "hybrid",
+          "rise": 3.1149939255558747,
+          "twist": 27.448958336697046
+        }
+      ]
+    }
+  ],
+  "dotBracket": {
+    "sequence": "AAAGGGTTAGGGTTAGGGTTAGGGAA",
+    "line1": "...([{...(((...)))...)]}..",
+    "line2": "...([{...)]}...(((...))).."
+  }
+}
+```
+
+</details>
+
+## 4RJ1: Structural variations and solvent structure of UGGGGU quadruplexes stabilized by Sr2+ ions
+
+![](4rj1.png)
+
+    $ curl https://www.ebi.ac.uk/pdbe/static/entry/download/4rj1-assembly-1.cif.gz | gzip -d > 4rj1-1.cif
+    $ ./eltetrado --input 4rj1-1.cif --output 4rj1-1.json
+
+    Chain order: A AB AA AC B BC BA BB
+    n4-helix with 10 tetrads
+      Op* VIII n/a quadruplex with 5 tetrads
+        A.U1006 AC.U1006 AA.U1006 AB.U1006 cWH cWH cWH cWH O- VIIIa planarity=1.06 ions_channel=NA ions_outside=A.U1006: [SR] AA.U1006: [SR] AB.U1006: [SR] AC.U1006: [SR]
+          direction=parallel rise=3.37 twist=39.96
+        A.G1005 AC.G1005 AA.G1005 AB.G1005 cHW cHW cHW cHW O+ VIIIa planarity=0.8  
+          direction=parallel rise=3.31 twist=25.9
+        A.G1004 AC.G1004 AA.G1004 AB.G1004 cHW cHW cHW cHW O+ VIIIa planarity=0.41 ions_channel=SR 
+          direction=parallel rise=3.34 twist=35.81
+        A.G1003 AC.G1003 AA.G1003 AB.G1003 cHW cHW cHW cHW O+ VIIIa planarity=0.55 ions_channel=SR 
+          direction=parallel rise=3.29 twist=27.12
+        A.G1002 AC.G1002 AA.G1002 AB.G1002 cHW cHW cHW cHW O+ VIIIa planarity=0.54  ions_outside=AB.G1002: [CA] AC.G1002: [CA] AA.G1002: [CA] A.G1002: [CA]
+
+        Tracts:
+          A.U1006, A.G1005, A.G1004, A.G1003, A.G1002
+          AC.U1006, AC.G1005, AC.G1004, AC.G1003, AC.G1002
+          AA.U1006, AA.G1005, AA.G1004, AA.G1003, AA.G1002
+          AB.U1006, AB.G1005, AB.G1004, AB.G1003, AB.G1002
+
+      Op* VIII n/a quadruplex with 5 tetrads
+        B.G2002 BC.G2002 BA.G2002 BB.G2002 cWH cWH cWH cWH O+ VIIIa planarity=0.67  
+          direction=parallel rise=3.37 twist=27.41
+        B.G2003 BC.G2003 BA.G2003 BB.G2003 cWH cWH cWH cWH O+ VIIIa planarity=0.58 ions_channel=SR ions_outside=B.G2003: [CA] BA.G2003: [CA] BB.G2003: [CA] BC.G2003: [CA]
+          direction=parallel rise=3.32 twist=35.04
+        B.G2004 BC.G2004 BA.G2004 BB.G2004 cWH cWH cWH cWH O+ VIIIa planarity=0.23 ions_channel=SR 
+          direction=parallel rise=3.27 twist=25.15
+        B.G2005 BC.G2005 BA.G2005 BB.G2005 cWH cWH cWH cWH O+ VIIIa planarity=0.78 ions_channel=NA 
+          direction=parallel rise=7.14 twist=43.41
+        B.U2006 BC.U2006 BA.U2006 BB.U2006 cHW cHW cHW cHW O- VIIIa planarity=1.58 ions_channel=NA,NA 
+
+        Tracts:
+          B.G2002, B.G2003, B.G2004, B.G2005, B.U2006
+          BC.G2002, BC.G2003, BC.G2004, BC.G2005, BC.U2006
+          BA.G2002, BA.G2003, BA.G2004, BA.G2005, BA.U2006
+          BB.G2002, BB.G2003, BB.G2004, BB.G2005, BB.U2006
+
+    UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU
+    .([{<A-.([{<A-.)]}>a-.)]}>a-.([{<A-.)]}>a-.([{<A-.)]}>a
+    .([{<A-.)]}>a-.([{<A-.)]}>a-.([{<A-.([{<A-.)]}>a-.)]}>a
+
+<details>
+<summary>
+Click to see the output JSON
+</summary>
+
+``` json
+{
+  "metals": [
+    {
+      "symbol": "Sr",
+      "count": 8
+    },
+    {
+      "symbol": "Na",
+      "count": 4
+    },
+    {
+      "symbol": "Ca",
+      "count": 12
+    }
+  ],
+  "nucleotides": [
+    {
+      "index": 1,
+      "chain": "A",
+      "number": 1001,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "A.U1001",
+      "shortName": "U",
+      "chi": -141.92671313255752,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 2,
+      "chain": "A",
+      "number": 1002,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "A.G1002",
+      "shortName": "G",
+      "chi": -165.93034671112116,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 3,
+      "chain": "A",
+      "number": 1003,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "A.G1003",
+      "shortName": "G",
+      "chi": -121.5652426033226,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 4,
+      "chain": "A",
+      "number": 1004,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "A.G1004",
+      "shortName": "G",
+      "chi": -156.00957673923344,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 5,
+      "chain": "A",
+      "number": 1005,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "A.G1005",
+      "shortName": "G",
+      "chi": -148.10051684016415,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 6,
+      "chain": "A",
+      "number": 1006,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "A.U1006",
+      "shortName": "U",
+      "chi": -137.28005568139983,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 13,
+      "chain": "AA",
+      "number": 1001,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AA.U1001",
+      "shortName": "U",
+      "chi": -141.9267131325575,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 14,
+      "chain": "AA",
+      "number": 1002,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AA.G1002",
+      "shortName": "G",
+      "chi": -165.93034671112113,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 15,
+      "chain": "AA",
+      "number": 1003,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AA.G1003",
+      "shortName": "G",
+      "chi": -121.56524260332266,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 16,
+      "chain": "AA",
+      "number": 1004,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AA.G1004",
+      "shortName": "G",
+      "chi": -156.0095767392335,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 17,
+      "chain": "AA",
+      "number": 1005,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AA.G1005",
+      "shortName": "G",
+      "chi": -148.10051684016406,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 18,
+      "chain": "AA",
+      "number": 1006,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AA.U1006",
+      "shortName": "U",
+      "chi": -137.2800556813998,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 7,
+      "chain": "AB",
+      "number": 1001,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AB.U1001",
+      "shortName": "U",
+      "chi": -141.9267131325574,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 8,
+      "chain": "AB",
+      "number": 1002,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AB.G1002",
+      "shortName": "G",
+      "chi": -165.93034671112113,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 9,
+      "chain": "AB",
+      "number": 1003,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AB.G1003",
+      "shortName": "G",
+      "chi": -121.56524260332266,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 10,
+      "chain": "AB",
+      "number": 1004,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AB.G1004",
+      "shortName": "G",
+      "chi": -156.00957673923347,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 11,
+      "chain": "AB",
+      "number": 1005,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AB.G1005",
+      "shortName": "G",
+      "chi": -148.10051684016406,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 12,
+      "chain": "AB",
+      "number": 1006,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AB.U1006",
+      "shortName": "U",
+      "chi": -137.28005568139977,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 19,
+      "chain": "AC",
+      "number": 1001,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AC.U1001",
+      "shortName": "U",
+      "chi": -141.92671313255747,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 20,
+      "chain": "AC",
+      "number": 1002,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AC.G1002",
+      "shortName": "G",
+      "chi": -165.93034671112116,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 21,
+      "chain": "AC",
+      "number": 1003,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AC.G1003",
+      "shortName": "G",
+      "chi": -121.56524260332266,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 22,
+      "chain": "AC",
+      "number": 1004,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AC.G1004",
+      "shortName": "G",
+      "chi": -156.00957673923352,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 23,
+      "chain": "AC",
+      "number": 1005,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AC.G1005",
+      "shortName": "G",
+      "chi": -148.1005168401641,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 24,
+      "chain": "AC",
+      "number": 1006,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AC.U1006",
+      "shortName": "U",
+      "chi": -137.28005568139986,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 25,
+      "chain": "B",
+      "number": 2001,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "B.U2001",
+      "shortName": "U",
+      "chi": -146.4615316869476,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 26,
+      "chain": "B",
+      "number": 2002,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "B.G2002",
+      "shortName": "G",
+      "chi": -170.79660912745996,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 27,
+      "chain": "B",
+      "number": 2003,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "B.G2003",
+      "shortName": "G",
+      "chi": -117.68718110874113,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 28,
+      "chain": "B",
+      "number": 2004,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "B.G2004",
+      "shortName": "G",
+      "chi": -153.88587375071324,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 29,
+      "chain": "B",
+      "number": 2005,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "B.G2005",
+      "shortName": "G",
+      "chi": -148.8519912845669,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 30,
+      "chain": "B",
+      "number": 2006,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "B.U2006",
+      "shortName": "U",
+      "chi": -159.43730655241544,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 37,
+      "chain": "BA",
+      "number": 2001,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BA.U2001",
+      "shortName": "U",
+      "chi": -146.46153168694764,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 38,
+      "chain": "BA",
+      "number": 2002,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BA.G2002",
+      "shortName": "G",
+      "chi": -170.79660912745993,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 39,
+      "chain": "BA",
+      "number": 2003,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BA.G2003",
+      "shortName": "G",
+      "chi": -117.68718110874113,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 40,
+      "chain": "BA",
+      "number": 2004,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BA.G2004",
+      "shortName": "G",
+      "chi": -153.88587375071322,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 41,
+      "chain": "BA",
+      "number": 2005,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BA.G2005",
+      "shortName": "G",
+      "chi": -148.851991284567,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 42,
+      "chain": "BA",
+      "number": 2006,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BA.U2006",
+      "shortName": "U",
+      "chi": -159.43730655241544,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 43,
+      "chain": "BB",
+      "number": 2001,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BB.U2001",
+      "shortName": "U",
+      "chi": -146.4615316869476,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 44,
+      "chain": "BB",
+      "number": 2002,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BB.G2002",
+      "shortName": "G",
+      "chi": -170.79660912745993,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 45,
+      "chain": "BB",
+      "number": 2003,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BB.G2003",
+      "shortName": "G",
+      "chi": -117.68718110874106,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 46,
+      "chain": "BB",
+      "number": 2004,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BB.G2004",
+      "shortName": "G",
+      "chi": -153.8858737507132,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 47,
+      "chain": "BB",
+      "number": 2005,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BB.G2005",
+      "shortName": "G",
+      "chi": -148.85199128456696,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 48,
+      "chain": "BB",
+      "number": 2006,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BB.U2006",
+      "shortName": "U",
+      "chi": -159.43730655241544,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 31,
+      "chain": "BC",
+      "number": 2001,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BC.U2001",
+      "shortName": "U",
+      "chi": -146.4615316869476,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 32,
+      "chain": "BC",
+      "number": 2002,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BC.G2002",
+      "shortName": "G",
+      "chi": -170.79660912745993,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 33,
+      "chain": "BC",
+      "number": 2003,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BC.G2003",
+      "shortName": "G",
+      "chi": -117.68718110874121,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 34,
+      "chain": "BC",
+      "number": 2004,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BC.G2004",
+      "shortName": "G",
+      "chi": -153.88587375071322,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 35,
+      "chain": "BC",
+      "number": 2005,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BC.G2005",
+      "shortName": "G",
+      "chi": -148.85199128456694,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 36,
+      "chain": "BC",
+      "number": 2006,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BC.U2006",
+      "shortName": "U",
+      "chi": -159.43730655241544,
+      "glycosidicBond": "anti"
+    }
+  ],
+  "basePairs": [
+    {
+      "nt1": "A.G1002",
+      "nt2": "AB.G1002",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "A.G1002",
+      "nt2": "AC.G1002",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "A.G1003",
+      "nt2": "AB.G1003",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "A.G1003",
+      "nt2": "AC.G1003",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "A.G1004",
+      "nt2": "AB.G1004",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "A.G1004",
+      "nt2": "AC.G1004",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "A.G1005",
+      "nt2": "AB.G1005",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "A.G1005",
+      "nt2": "AC.G1005",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "A.U1006",
+      "nt2": "AB.U1006",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "A.U1006",
+      "nt2": "AC.U1006",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "AB.G1002",
+      "nt2": "AA.G1002",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "AA.G1002",
+      "nt2": "AC.G1002",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "AB.G1003",
+      "nt2": "AA.G1003",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "AA.G1003",
+      "nt2": "AC.G1003",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "AB.G1004",
+      "nt2": "AA.G1004",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "AA.G1004",
+      "nt2": "AC.G1004",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "AB.G1005",
+      "nt2": "AA.G1005",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "AA.G1005",
+      "nt2": "AC.G1005",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "AB.U1006",
+      "nt2": "AA.U1006",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "AA.U1006",
+      "nt2": "AC.U1006",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "B.G2002",
+      "nt2": "BB.G2002",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "B.G2002",
+      "nt2": "BC.G2002",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "B.G2003",
+      "nt2": "BB.G2003",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "B.G2003",
+      "nt2": "BC.G2003",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "B.G2004",
+      "nt2": "BB.G2004",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "B.G2004",
+      "nt2": "BC.G2004",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "B.G2005",
+      "nt2": "BB.G2005",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "B.G2005",
+      "nt2": "BC.G2005",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "B.U2006",
+      "nt2": "BB.U2006",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "B.U2006",
+      "nt2": "BC.U2006",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "BA.G2002",
+      "nt2": "BB.G2002",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "BC.G2002",
+      "nt2": "BA.G2002",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "BA.G2003",
+      "nt2": "BB.G2003",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "BC.G2003",
+      "nt2": "BA.G2003",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "BA.G2004",
+      "nt2": "BB.G2004",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "BC.G2004",
+      "nt2": "BA.G2004",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "BA.G2005",
+      "nt2": "BB.G2005",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "BC.G2005",
+      "nt2": "BA.G2005",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "BA.U2006",
+      "nt2": "BB.U2006",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "BC.U2006",
+      "nt2": "BA.U2006",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    }
+  ],
+  "helices": [
+    {
+      "quadruplexes": [
+        {
+          "tetrads": [
+            {
+              "id": "A.U1006-AC.U1006-AA.U1006-AB.U1006",
+              "nt1": "A.U1006",
+              "nt2": "AC.U1006",
+              "nt3": "AA.U1006",
+              "nt4": "AB.U1006",
+              "onz": "O-",
+              "gbaClassification": "VIIIa",
+              "planarityDeviation": 1.061,
+              "ionsChannel": [
+                "NA"
+              ],
+              "ionsOutside": [
+                {
+                  "nt": "A.U1006",
+                  "ion": "SR"
+                },
+                {
+                  "nt": "AA.U1006",
+                  "ion": "SR"
+                },
+                {
+                  "nt": "AB.U1006",
+                  "ion": "SR"
+                },
+                {
+                  "nt": "AC.U1006",
+                  "ion": "SR"
+                }
+              ]
+            },
+            {
+              "id": "A.G1005-AC.G1005-AA.G1005-AB.G1005",
+              "nt1": "A.G1005",
+              "nt2": "AC.G1005",
+              "nt3": "AA.G1005",
+              "nt4": "AB.G1005",
+              "onz": "O+",
+              "gbaClassification": "VIIIa",
+              "planarityDeviation": 0.7999999999999972,
+              "ionsChannel": [],
+              "ionsOutside": []
+            },
+            {
+              "id": "A.G1004-AC.G1004-AA.G1004-AB.G1004",
+              "nt1": "A.G1004",
+              "nt2": "AC.G1004",
+              "nt3": "AA.G1004",
+              "nt4": "AB.G1004",
+              "onz": "O+",
+              "gbaClassification": "VIIIa",
+              "planarityDeviation": 0.4059999999999988,
+              "ionsChannel": [
+                "SR"
+              ],
+              "ionsOutside": []
+            },
+            {
+              "id": "A.G1003-AC.G1003-AA.G1003-AB.G1003",
+              "nt1": "A.G1003",
+              "nt2": "AC.G1003",
+              "nt3": "AA.G1003",
+              "nt4": "AB.G1003",
+              "onz": "O+",
+              "gbaClassification": "VIIIa",
+              "planarityDeviation": 0.5549999999999997,
+              "ionsChannel": [
+                "SR"
+              ],
+              "ionsOutside": []
+            },
+            {
+              "id": "A.G1002-AC.G1002-AA.G1002-AB.G1002",
+              "nt1": "A.G1002",
+              "nt2": "AC.G1002",
+              "nt3": "AA.G1002",
+              "nt4": "AB.G1002",
+              "onz": "O+",
+              "gbaClassification": "VIIIa",
+              "planarityDeviation": 0.541999999999998,
+              "ionsChannel": [],
+              "ionsOutside": [
+                {
+                  "nt": "AB.G1002",
+                  "ion": "CA"
+                },
+                {
+                  "nt": "AC.G1002",
+                  "ion": "CA"
+                },
+                {
+                  "nt": "AA.G1002",
+                  "ion": "CA"
+                },
+                {
+                  "nt": "A.G1002",
+                  "ion": "CA"
+                }
+              ]
+            }
+          ],
+          "onzm": "Op*",
+          "loopClassification": null,
+          "gbaClassification": [
+            "VIII"
+          ],
+          "tracts": [
+            [
+              "A.U1006",
+              "A.G1005",
+              "A.G1004",
+              "A.G1003",
+              "A.G1002"
+            ],
+            [
+              "AC.U1006",
+              "AC.G1005",
+              "AC.G1004",
+              "AC.G1003",
+              "AC.G1002"
+            ],
+            [
+              "AA.U1006",
+              "AA.G1005",
+              "AA.G1004",
+              "AA.G1003",
+              "AA.G1002"
+            ],
+            [
+              "AB.U1006",
+              "AB.G1005",
+              "AB.G1004",
+              "AB.G1003",
+              "AB.G1002"
+            ]
+          ],
+          "loops": []
+        },
+        {
+          "tetrads": [
+            {
+              "id": "B.G2002-BC.G2002-BA.G2002-BB.G2002",
+              "nt1": "B.G2002",
+              "nt2": "BC.G2002",
+              "nt3": "BA.G2002",
+              "nt4": "BB.G2002",
+              "onz": "O+",
+              "gbaClassification": "VIIIa",
+              "planarityDeviation": 0.6730000000000018,
+              "ionsChannel": [],
+              "ionsOutside": []
+            },
+            {
+              "id": "B.G2003-BC.G2003-BA.G2003-BB.G2003",
+              "nt1": "B.G2003",
+              "nt2": "BC.G2003",
+              "nt3": "BA.G2003",
+              "nt4": "BB.G2003",
+              "onz": "O+",
+              "gbaClassification": "VIIIa",
+              "planarityDeviation": 0.5769999999999982,
+              "ionsChannel": [
+                "SR"
+              ],
+              "ionsOutside": [
+                {
+                  "nt": "B.G2003",
+                  "ion": "CA"
+                },
+                {
+                  "nt": "BA.G2003",
+                  "ion": "CA"
+                },
+                {
+                  "nt": "BB.G2003",
+                  "ion": "CA"
+                },
+                {
+                  "nt": "BC.G2003",
+                  "ion": "CA"
+                }
+              ]
+            },
+            {
+              "id": "B.G2004-BC.G2004-BA.G2004-BB.G2004",
+              "nt1": "B.G2004",
+              "nt2": "BC.G2004",
+              "nt3": "BA.G2004",
+              "nt4": "BB.G2004",
+              "onz": "O+",
+              "gbaClassification": "VIIIa",
+              "planarityDeviation": 0.2289999999999992,
+              "ionsChannel": [
+                "SR"
+              ],
+              "ionsOutside": []
+            },
+            {
+              "id": "B.G2005-BC.G2005-BA.G2005-BB.G2005",
+              "nt1": "B.G2005",
+              "nt2": "BC.G2005",
+              "nt3": "BA.G2005",
+              "nt4": "BB.G2005",
+              "onz": "O+",
+              "gbaClassification": "VIIIa",
+              "planarityDeviation": 0.7810000000000006,
+              "ionsChannel": [
+                "NA"
+              ],
+              "ionsOutside": []
+            },
+            {
+              "id": "B.U2006-BC.U2006-BA.U2006-BB.U2006",
+              "nt1": "B.U2006",
+              "nt2": "BC.U2006",
+              "nt3": "BA.U2006",
+              "nt4": "BB.U2006",
+              "onz": "O-",
+              "gbaClassification": "VIIIa",
+              "planarityDeviation": 1.5840000000000005,
+              "ionsChannel": [
+                "NA",
+                "NA"
+              ],
+              "ionsOutside": []
+            }
+          ],
+          "onzm": "Op*",
+          "loopClassification": null,
+          "gbaClassification": [
+            "VIII"
+          ],
+          "tracts": [
+            [
+              "B.G2002",
+              "B.G2003",
+              "B.G2004",
+              "B.G2005",
+              "B.U2006"
+            ],
+            [
+              "BC.G2002",
+              "BC.G2003",
+              "BC.G2004",
+              "BC.G2005",
+              "BC.U2006"
+            ],
+            [
+              "BA.G2002",
+              "BA.G2003",
+              "BA.G2004",
+              "BA.G2005",
+              "BA.U2006"
+            ],
+            [
+              "BB.G2002",
+              "BB.G2003",
+              "BB.G2004",
+              "BB.G2005",
+              "BB.U2006"
+            ]
+          ],
+          "loops": []
+        }
+      ],
+      "tetradPairs": [
+        {
+          "tetrad1": "A.U1006-AC.U1006-AA.U1006-AB.U1006",
+          "tetrad2": "A.G1005-AC.G1005-AA.G1005-AB.G1005",
+          "direction": "parallel",
+          "rise": 3.366499999999995,
+          "twist": 39.962531742191736
+        },
+        {
+          "tetrad1": "A.G1005-AC.G1005-AA.G1005-AB.G1005",
+          "tetrad2": "A.G1004-AC.G1004-AA.G1004-AB.G1004",
+          "direction": "parallel",
+          "rise": 3.308000000000007,
+          "twist": 25.89614444631925
+        },
+        {
+          "tetrad1": "A.G1004-AC.G1004-AA.G1004-AB.G1004",
+          "tetrad2": "A.G1003-AC.G1003-AA.G1003-AB.G1003",
+          "direction": "parallel",
+          "rise": 3.339499999999994,
+          "twist": 35.81115298630443
+        },
+        {
+          "tetrad1": "A.G1003-AC.G1003-AA.G1003-AB.G1003",
+          "tetrad2": "A.G1002-AC.G1002-AA.G1002-AB.G1002",
+          "direction": "parallel",
+          "rise": 3.2865,
+          "twist": 27.11515971986803
+        },
+        {
+          "tetrad1": "A.G1002-AC.G1002-AA.G1002-AB.G1002",
+          "tetrad2": "B.G2002-BC.G2002-BA.G2002-BB.G2002",
+          "direction": "parallel",
+          "rise": 3.369500000000002,
+          "twist": 28.993180312675573
+        },
+        {
+          "tetrad1": "B.G2002-BC.G2002-BA.G2002-BB.G2002",
+          "tetrad2": "B.G2003-BC.G2003-BA.G2003-BB.G2003",
+          "direction": "parallel",
+          "rise": 3.371000000000002,
+          "twist": 27.410084968596852
+        },
+        {
+          "tetrad1": "B.G2003-BC.G2003-BA.G2003-BB.G2003",
+          "tetrad2": "B.G2004-BC.G2004-BA.G2004-BB.G2004",
+          "direction": "parallel",
+          "rise": 3.318000000000005,
+          "twist": 35.04072146975963
+        },
+        {
+          "tetrad1": "B.G2004-BC.G2004-BA.G2004-BB.G2004",
+          "tetrad2": "B.G2005-BC.G2005-BA.G2005-BB.G2005",
+          "direction": "parallel",
+          "rise": 3.2689999999999966,
+          "twist": 25.149997949938147
+        },
+        {
+          "tetrad1": "B.G2005-BC.G2005-BA.G2005-BB.G2005",
+          "tetrad2": "B.U2006-BC.U2006-BA.U2006-BB.U2006",
+          "direction": "parallel",
+          "rise": 7.140499999999998,
+          "twist": 43.40609492262336
+        }
+      ]
+    }
+  ],
+  "dotBracket": {
+    "sequence": "UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU",
+    "line1": ".([{<A-.([{<A-.)]}>a-.)]}>a-.([{<A-.)]}>a-.([{<A-.)]}>a",
+    "line2": ".([{<A-.)]}>a-.([{<A-.)]}>a-.([{<A-.([{<A-.)]}>a-.)]}>a"
+  }
+}
+```
+
+</details>
+
+# Funding
+
+This research was supported by the National Science Centre, Poland
+\[2016/23/B/ST6/03931, 2019/35/B/ST6/03074\] and Mloda Kadra project
+\[09/91/SBAD/0684\] from Poznan University of Technology, and carried
+out in the European Centre for Bioinformatics and Genomics (Poland). The
+authors also acknowledge partial support by the statutory funds of
+Poznan University of Technology, Polish Ministry of Science and Higher
+Education, and the Institute of Bioorganic Chemistry, PAS within
+intramural financing program.
+
+# Bibliography
+
+<div id="refs" class="references csl-bib-body">
+
+1.  Topology-Based Classification of Tetrads and Quadruplex
+    Structures. M. Popenda, J. Miskiewicz, J. Sarzynska, T. Zok, M.
+    Szachniuk. *Bioinformatics*. 2020. 36(4):1129–1134.
+    doi:[10.1093/bioinformatics/btz738](https://doi.org/10.1093/bioinformatics/btz738)
+
+2.  ElTetrado: A Tool for Identification and Classification of Tetrads
+    and Quadruplexes. T. Zok, M. Popenda, M. Szachniuk. *BMC
+    Bioinformatics*. 2020. 21(1):40.
+    doi:[10.1186/s12859-020-3385-1](https://doi.org/10.1186/s12859-020-3385-1)
+
+3.  R-Chie : A Web Server and R Package for Visualizing RNA Secondary
+    Structures. D. Lai, J.R. Proctor, J.Y.A. Zhu, I.M. Meyer. *Nucleic
+    Acids Research*. 2012. 40(12):e95.
+    doi:[f99845](https://doi.org/f99845)
+
+4.  Geometric Nomenclature and Classification of RNA Base Pairs. N.B.
+    Leontis, E. Westhof. *RNA*. 2001. 7(4):499–512.
+    doi:[10.1017/s1355838201002515](https://doi.org/10.1017/s1355838201002515)
+
+</div>
+
+
+%package help
+Summary:	Development documents and examples for eltetrado
+Provides:	python3-eltetrado-doc
+%description help
+![](logo.svg)
+
+# Project description
+
+This is an application to analyze base pairing patterns of DNA/RNA 3D
+structures to find and classify tetrads and quadruplexes. ElTetrado
+assigns tetrads to one of the ONZ classes (O, N, Z) alongside with the
+directionality of the tetrad (+/-) determined by the bonds between bases
+and their non-canonical interactions. The interactions follow
+Leontis/Westhof classification (Leontis *et al.* 2001). Watson-Crick (W)
+edge of first base in the tetrad structure exposed to the Hoogsteen (H)
+edge of the next nucleobase from the same tetrad sets the tetrad
+directionality, clockwise (+) or anticlockwise (-). For more details,
+please refer to Zok *et al.* (2020) and Popenda *et al.* (2020)
+
+# Installation
+
+Please run:
+
+    pip install eltetrado
+
+If you have both Python 2 and Python 3 installed, you need to explicitly
+call `pip3`:
+
+    pip3 install eltetrado
+
+# Dependencies
+
+The project is written in Python 3.6+ and requires
+[mmcif](https://pypi.org/project/mmcif/),
+[orjson](https://github.com/ijl/orjson), [NumPy](https://numpy.org/) and
+[requests](https://docs.python-requests.org/en/latest/).
+
+Visualization is created by `R` 3.6+ script which uses
+[R4RNA](https://www.e-rna.org/r-chie/) (Lai *et al.* 2012) library. The
+dependency will be automatically installed if not present.
+
+Base pairs and stacking interactions are identified by
+[RNApolis](https://github.com/tzok/rnapolis-py).
+
+# Usage
+
+ElTetrado is a command line application, which requires to be provided
+with `--input` and a path to a PDB or PDBx/mmCIF file.
+
+By default, ElTetrado outputs textual results on the standard output. A
+JSON version of the output can be obtained with `--output` switch
+followed by a path where the file is supposed to be created.
+
+ElTetrado prepares visualization of the whole structure and of each
+N4-helices, quadruplexes and tetrads. This can be supplemented with
+canonical base pairs visualization when `--complete-2d` is set. All
+color settings are located in the first several lines of the `quadraw.R`
+file, you can easily change them without knowledge of R language. If you
+want ElTetrado to not visualize anything, pass `--no-image` switch to
+it.
+
+    usage: eltetrado [-h] [-i INPUT] [-o OUTPUT] [-m MODEL]
+                     [--stacking-mismatch STACKING_MISMATCH] [--strict]
+                     [--no-reorder] [--complete-2d] [--no-image]
+                     [--dssr-json DSSR_JSON] [-v]
+
+    options:
+      -h, --help            show this help message and exit
+      -i INPUT, --input INPUT
+                            path to input PDB or PDBx/mmCIF file
+      -o OUTPUT, --output OUTPUT
+                            (optional) path for output JSON file
+      -m MODEL, --model MODEL
+                            (optional) model number to process
+      --stacking-mismatch STACKING_MISMATCH
+                            a perfect tetrad stacking covers 4 nucleotides; this
+                            option can be used with value 1 or 2 to allow this
+                            number of nucleotides to be non-stacked with otherwise
+                            well aligned tetrad [default=2]
+      --strict              nucleotides in tetrad are found when linked only by
+                            cWH pairing
+      --no-reorder          chains of bi- and tetramolecular quadruplexes should
+                            be reordered to be able to have them classified; when
+                            this is set, chains will be processed in original
+                            order, which for bi-/tetramolecular means that they
+                            will likely be misclassified; use with care!
+      --complete-2d         when set, the visualization will also show canonical
+                            base pairs to provide context for the quadruplex
+      --no-image            when set, the visualization will not be created at all
+      --dssr-json DSSR_JSON
+                            (optional) provide a JSON file generated by DSSR to
+                            read the secondary structure information from (use
+                            --nmr and --json switches)
+      -v, --version         show program's version number and exit
+
+# Chains reorder
+
+ElTetrado keeps a global and unique 5’-3’ index for every nucleotide
+which is independent from residue numbers. For example, if a structure
+has chain M with 60 nucleotides and chain N with 15 nucleotides, then
+ElTetrado will keep index between 0 and 74 which uniquely identifies
+every nucleotide. Initially, ElTetrado assigns this indices according to
+the order of chains in the input file. Therefore, if M preceded N then
+nucleotides in M will be indexed from 0 to 59 and in N from 60 to 74.
+Otherwise, nucleotides in N will be indexed from 0 to 14 and in M from
+15 to 74.
+
+When `--no-reorder` is present, this initial assignment is used.
+Otherwise, ElTetrado exhaustively checks all permutations of chains’
+orders. Every permutation check induces recalculation of the global and
+unique 5’-3’ index and in effect it changes ONZ classification of
+tetrads.
+
+ElTetrado keeps a table of tetrad classification scores according to
+these rules:
+
+- Type preference: `O` \> `N` \> `Z`
+- Direction preference: `+` \> `-`
+
+The table keeps low values for preferred classes i.e. `O+` is 0, `O-` is
+1 and so on up to `Z-` with score 5. For every permutation of chain
+orders, ElTetrado computes sum of scores for tetrads classification
+induced by 5’-3’ indexing. We select permutation with the minimum value.
+
+# Examples
+
+## 2HY9: Human telomere DNA quadruplex structure in K+ solution hybrid-1 form
+
+![](2hy9.png)
+
+    $ curl ftp://ftp.wwpdb.org/pub/pdb/data/structures/divided/mmCIF/my/2hy9.cif.gz | gzip -d > 2hy9.cif
+    $ ./eltetrado --input 2hy9.cif --output 2hy9.json
+
+    Chain order: 1
+    n4-helix with 3 tetrads
+      Oh* V,VI 9a -(pll) quadruplex with 3 tetrads
+        1.DG4 1.DG22 1.DG18 1.DG10 cWH cWH cWH cWH O- Vb planarity=0.17  
+          direction=hybrid rise=3.21 twist=16.23
+        1.DG5 1.DG23 1.DG17 1.DG11 cHW cHW cHW cHW O+ Va planarity=0.1  
+          direction=hybrid rise=3.11 twist=27.45
+        1.DG6 1.DG24 1.DG16 1.DG12 cHW cHW cHW cHW O+ VIa planarity=0.18  
+
+        Tracts:
+          1.DG4, 1.DG5, 1.DG6
+          1.DG22, 1.DG23, 1.DG24
+          1.DG18, 1.DG17, 1.DG16
+          1.DG10, 1.DG11, 1.DG12
+
+        Loops:
+          propeller- 1.DT7, 1.DT8, 1.DA9
+          lateral- 1.DT13, 1.DT14, 1.DA15
+          lateral+ 1.DT19, 1.DT20, 1.DA21
+
+    AAAGGGTTAGGGTTAGGGTTAGGGAA
+    ...([{...(((...)))...)]}..
+    ...([{...)]}...(((...)))..
+
+<details>
+<summary>
+Click to see the output JSON
+</summary>
+
+``` json
+{
+  "metals": [],
+  "nucleotides": [
+    {
+      "index": 1,
+      "chain": "1",
+      "number": 1,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DA1",
+      "shortName": "A",
+      "chi": 22.308282830857802,
+      "glycosidicBond": "syn"
+    },
+    {
+      "index": 2,
+      "chain": "1",
+      "number": 2,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DA2",
+      "shortName": "A",
+      "chi": -123.05454402191421,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 3,
+      "chain": "1",
+      "number": 3,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DA3",
+      "shortName": "A",
+      "chi": -94.96579955603106,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 4,
+      "chain": "1",
+      "number": 4,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DG4",
+      "shortName": "G",
+      "chi": 79.28363721639316,
+      "glycosidicBond": "syn"
+    },
+    {
+      "index": 5,
+      "chain": "1",
+      "number": 5,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DG5",
+      "shortName": "G",
+      "chi": -126.01709201555563,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 6,
+      "chain": "1",
+      "number": 6,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DG6",
+      "shortName": "G",
+      "chi": -127.26656202302102,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 7,
+      "chain": "1",
+      "number": 7,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DT7",
+      "shortName": "T",
+      "chi": -63.10830751967371,
+      "glycosidicBond": "syn"
+    },
+    {
+      "index": 8,
+      "chain": "1",
+      "number": 8,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DT8",
+      "shortName": "T",
+      "chi": -138.79520345559828,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 9,
+      "chain": "1",
+      "number": 9,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DA9",
+      "shortName": "A",
+      "chi": -148.83990757408878,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 10,
+      "chain": "1",
+      "number": 10,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DG10",
+      "shortName": "G",
+      "chi": 58.7787525019158,
+      "glycosidicBond": "syn"
+    },
+    {
+      "index": 11,
+      "chain": "1",
+      "number": 11,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DG11",
+      "shortName": "G",
+      "chi": -123.85746807924986,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 12,
+      "chain": "1",
+      "number": 12,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DG12",
+      "shortName": "G",
+      "chi": -84.36679807284759,
+      "glycosidicBond": "syn"
+    },
+    {
+      "index": 13,
+      "chain": "1",
+      "number": 13,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DT13",
+      "shortName": "T",
+      "chi": -30.819029132834157,
+      "glycosidicBond": "syn"
+    },
+    {
+      "index": 14,
+      "chain": "1",
+      "number": 14,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DT14",
+      "shortName": "T",
+      "chi": -168.51776782812965,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 15,
+      "chain": "1",
+      "number": 15,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DA15",
+      "shortName": "A",
+      "chi": -105.72881577106517,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 16,
+      "chain": "1",
+      "number": 16,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DG16",
+      "shortName": "G",
+      "chi": 74.3227942181243,
+      "glycosidicBond": "syn"
+    },
+    {
+      "index": 17,
+      "chain": "1",
+      "number": 17,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DG17",
+      "shortName": "G",
+      "chi": 81.08424926936044,
+      "glycosidicBond": "syn"
+    },
+    {
+      "index": 18,
+      "chain": "1",
+      "number": 18,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DG18",
+      "shortName": "G",
+      "chi": -122.90397217111551,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 19,
+      "chain": "1",
+      "number": 19,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DT19",
+      "shortName": "T",
+      "chi": -102.98239337113938,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 20,
+      "chain": "1",
+      "number": 20,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DT20",
+      "shortName": "T",
+      "chi": -112.1514601849715,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 21,
+      "chain": "1",
+      "number": 21,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DA21",
+      "shortName": "A",
+      "chi": -89.07113063649612,
+      "glycosidicBond": "syn"
+    },
+    {
+      "index": 22,
+      "chain": "1",
+      "number": 22,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DG22",
+      "shortName": "G",
+      "chi": 83.44318693001902,
+      "glycosidicBond": "syn"
+    },
+    {
+      "index": 23,
+      "chain": "1",
+      "number": 23,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DG23",
+      "shortName": "G",
+      "chi": -115.41210237198398,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 24,
+      "chain": "1",
+      "number": 24,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DG24",
+      "shortName": "G",
+      "chi": -111.14845782593531,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 25,
+      "chain": "1",
+      "number": 25,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DA25",
+      "shortName": "A",
+      "chi": -58.323530637551954,
+      "glycosidicBond": "syn"
+    },
+    {
+      "index": 26,
+      "chain": "1",
+      "number": 26,
+      "icode": null,
+      "molecule": "DNA",
+      "fullName": "1.DA26",
+      "shortName": "A",
+      "chi": -90.84065243137135,
+      "glycosidicBond": "anti"
+    }
+  ],
+  "basePairs": [
+    {
+      "nt1": "1.DA3",
+      "nt2": "1.DA21",
+      "lw": "cHW",
+      "inTetrad": false,
+      "canonical": false
+    },
+    {
+      "nt1": "1.DG4",
+      "nt2": "1.DG10",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "1.DG4",
+      "nt2": "1.DG22",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "1.DG5",
+      "nt2": "1.DG11",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "1.DG5",
+      "nt2": "1.DG23",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "1.DG6",
+      "nt2": "1.DG12",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "1.DG6",
+      "nt2": "1.DG24",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "1.DG10",
+      "nt2": "1.DG18",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "1.DG11",
+      "nt2": "1.DG17",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "1.DG12",
+      "nt2": "1.DG16",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "1.DT14",
+      "nt2": "1.DA25",
+      "lw": "tWW",
+      "inTetrad": false,
+      "canonical": false
+    },
+    {
+      "nt1": "1.DG16",
+      "nt2": "1.DG24",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "1.DG17",
+      "nt2": "1.DG23",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "1.DG18",
+      "nt2": "1.DG22",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    }
+  ],
+  "helices": [
+    {
+      "quadruplexes": [
+        {
+          "tetrads": [
+            {
+              "id": "1.DG4-1.DG22-1.DG18-1.DG10",
+              "nt1": "1.DG4",
+              "nt2": "1.DG22",
+              "nt3": "1.DG18",
+              "nt4": "1.DG10",
+              "onz": "O-",
+              "gbaClassification": "Vb",
+              "planarityDeviation": 0.17372283960377805,
+              "ionsChannel": [],
+              "ionsOutside": []
+            },
+            {
+              "id": "1.DG5-1.DG23-1.DG17-1.DG11",
+              "nt1": "1.DG5",
+              "nt2": "1.DG23",
+              "nt3": "1.DG17",
+              "nt4": "1.DG11",
+              "onz": "O+",
+              "gbaClassification": "Va",
+              "planarityDeviation": 0.10474313820007483,
+              "ionsChannel": [],
+              "ionsOutside": []
+            },
+            {
+              "id": "1.DG6-1.DG24-1.DG16-1.DG12",
+              "nt1": "1.DG6",
+              "nt2": "1.DG24",
+              "nt3": "1.DG16",
+              "nt4": "1.DG12",
+              "onz": "O+",
+              "gbaClassification": "VIa",
+              "planarityDeviation": 0.18293509778060615,
+              "ionsChannel": [],
+              "ionsOutside": []
+            }
+          ],
+          "onzm": "Oh*",
+          "loopClassification": {
+            "classification": "9a",
+            "loopProgression": "-(pll)"
+          },
+          "gbaClassification": [
+            "V",
+            "VI"
+          ],
+          "tracts": [
+            [
+              "1.DG4",
+              "1.DG5",
+              "1.DG6"
+            ],
+            [
+              "1.DG22",
+              "1.DG23",
+              "1.DG24"
+            ],
+            [
+              "1.DG18",
+              "1.DG17",
+              "1.DG16"
+            ],
+            [
+              "1.DG10",
+              "1.DG11",
+              "1.DG12"
+            ]
+          ],
+          "loops": [
+            {
+              "type": "propeller-",
+              "nucleotides": [
+                "1.DT7",
+                "1.DT8",
+                "1.DA9"
+              ]
+            },
+            {
+              "type": "lateral-",
+              "nucleotides": [
+                "1.DT13",
+                "1.DT14",
+                "1.DA15"
+              ]
+            },
+            {
+              "type": "lateral+",
+              "nucleotides": [
+                "1.DT19",
+                "1.DT20",
+                "1.DA21"
+              ]
+            }
+          ]
+        }
+      ],
+      "tetradPairs": [
+        {
+          "tetrad1": "1.DG4-1.DG22-1.DG18-1.DG10",
+          "tetrad2": "1.DG5-1.DG23-1.DG17-1.DG11",
+          "direction": "hybrid",
+          "rise": 3.2109650905140654,
+          "twist": 16.228973729066034
+        },
+        {
+          "tetrad1": "1.DG5-1.DG23-1.DG17-1.DG11",
+          "tetrad2": "1.DG6-1.DG24-1.DG16-1.DG12",
+          "direction": "hybrid",
+          "rise": 3.1149939255558747,
+          "twist": 27.448958336697046
+        }
+      ]
+    }
+  ],
+  "dotBracket": {
+    "sequence": "AAAGGGTTAGGGTTAGGGTTAGGGAA",
+    "line1": "...([{...(((...)))...)]}..",
+    "line2": "...([{...)]}...(((...))).."
+  }
+}
+```
+
+</details>
+
+## 4RJ1: Structural variations and solvent structure of UGGGGU quadruplexes stabilized by Sr2+ ions
+
+![](4rj1.png)
+
+    $ curl https://www.ebi.ac.uk/pdbe/static/entry/download/4rj1-assembly-1.cif.gz | gzip -d > 4rj1-1.cif
+    $ ./eltetrado --input 4rj1-1.cif --output 4rj1-1.json
+
+    Chain order: A AB AA AC B BC BA BB
+    n4-helix with 10 tetrads
+      Op* VIII n/a quadruplex with 5 tetrads
+        A.U1006 AC.U1006 AA.U1006 AB.U1006 cWH cWH cWH cWH O- VIIIa planarity=1.06 ions_channel=NA ions_outside=A.U1006: [SR] AA.U1006: [SR] AB.U1006: [SR] AC.U1006: [SR]
+          direction=parallel rise=3.37 twist=39.96
+        A.G1005 AC.G1005 AA.G1005 AB.G1005 cHW cHW cHW cHW O+ VIIIa planarity=0.8  
+          direction=parallel rise=3.31 twist=25.9
+        A.G1004 AC.G1004 AA.G1004 AB.G1004 cHW cHW cHW cHW O+ VIIIa planarity=0.41 ions_channel=SR 
+          direction=parallel rise=3.34 twist=35.81
+        A.G1003 AC.G1003 AA.G1003 AB.G1003 cHW cHW cHW cHW O+ VIIIa planarity=0.55 ions_channel=SR 
+          direction=parallel rise=3.29 twist=27.12
+        A.G1002 AC.G1002 AA.G1002 AB.G1002 cHW cHW cHW cHW O+ VIIIa planarity=0.54  ions_outside=AB.G1002: [CA] AC.G1002: [CA] AA.G1002: [CA] A.G1002: [CA]
+
+        Tracts:
+          A.U1006, A.G1005, A.G1004, A.G1003, A.G1002
+          AC.U1006, AC.G1005, AC.G1004, AC.G1003, AC.G1002
+          AA.U1006, AA.G1005, AA.G1004, AA.G1003, AA.G1002
+          AB.U1006, AB.G1005, AB.G1004, AB.G1003, AB.G1002
+
+      Op* VIII n/a quadruplex with 5 tetrads
+        B.G2002 BC.G2002 BA.G2002 BB.G2002 cWH cWH cWH cWH O+ VIIIa planarity=0.67  
+          direction=parallel rise=3.37 twist=27.41
+        B.G2003 BC.G2003 BA.G2003 BB.G2003 cWH cWH cWH cWH O+ VIIIa planarity=0.58 ions_channel=SR ions_outside=B.G2003: [CA] BA.G2003: [CA] BB.G2003: [CA] BC.G2003: [CA]
+          direction=parallel rise=3.32 twist=35.04
+        B.G2004 BC.G2004 BA.G2004 BB.G2004 cWH cWH cWH cWH O+ VIIIa planarity=0.23 ions_channel=SR 
+          direction=parallel rise=3.27 twist=25.15
+        B.G2005 BC.G2005 BA.G2005 BB.G2005 cWH cWH cWH cWH O+ VIIIa planarity=0.78 ions_channel=NA 
+          direction=parallel rise=7.14 twist=43.41
+        B.U2006 BC.U2006 BA.U2006 BB.U2006 cHW cHW cHW cHW O- VIIIa planarity=1.58 ions_channel=NA,NA 
+
+        Tracts:
+          B.G2002, B.G2003, B.G2004, B.G2005, B.U2006
+          BC.G2002, BC.G2003, BC.G2004, BC.G2005, BC.U2006
+          BA.G2002, BA.G2003, BA.G2004, BA.G2005, BA.U2006
+          BB.G2002, BB.G2003, BB.G2004, BB.G2005, BB.U2006
+
+    UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU
+    .([{<A-.([{<A-.)]}>a-.)]}>a-.([{<A-.)]}>a-.([{<A-.)]}>a
+    .([{<A-.)]}>a-.([{<A-.)]}>a-.([{<A-.([{<A-.)]}>a-.)]}>a
+
+<details>
+<summary>
+Click to see the output JSON
+</summary>
+
+``` json
+{
+  "metals": [
+    {
+      "symbol": "Sr",
+      "count": 8
+    },
+    {
+      "symbol": "Na",
+      "count": 4
+    },
+    {
+      "symbol": "Ca",
+      "count": 12
+    }
+  ],
+  "nucleotides": [
+    {
+      "index": 1,
+      "chain": "A",
+      "number": 1001,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "A.U1001",
+      "shortName": "U",
+      "chi": -141.92671313255752,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 2,
+      "chain": "A",
+      "number": 1002,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "A.G1002",
+      "shortName": "G",
+      "chi": -165.93034671112116,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 3,
+      "chain": "A",
+      "number": 1003,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "A.G1003",
+      "shortName": "G",
+      "chi": -121.5652426033226,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 4,
+      "chain": "A",
+      "number": 1004,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "A.G1004",
+      "shortName": "G",
+      "chi": -156.00957673923344,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 5,
+      "chain": "A",
+      "number": 1005,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "A.G1005",
+      "shortName": "G",
+      "chi": -148.10051684016415,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 6,
+      "chain": "A",
+      "number": 1006,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "A.U1006",
+      "shortName": "U",
+      "chi": -137.28005568139983,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 13,
+      "chain": "AA",
+      "number": 1001,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AA.U1001",
+      "shortName": "U",
+      "chi": -141.9267131325575,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 14,
+      "chain": "AA",
+      "number": 1002,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AA.G1002",
+      "shortName": "G",
+      "chi": -165.93034671112113,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 15,
+      "chain": "AA",
+      "number": 1003,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AA.G1003",
+      "shortName": "G",
+      "chi": -121.56524260332266,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 16,
+      "chain": "AA",
+      "number": 1004,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AA.G1004",
+      "shortName": "G",
+      "chi": -156.0095767392335,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 17,
+      "chain": "AA",
+      "number": 1005,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AA.G1005",
+      "shortName": "G",
+      "chi": -148.10051684016406,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 18,
+      "chain": "AA",
+      "number": 1006,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AA.U1006",
+      "shortName": "U",
+      "chi": -137.2800556813998,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 7,
+      "chain": "AB",
+      "number": 1001,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AB.U1001",
+      "shortName": "U",
+      "chi": -141.9267131325574,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 8,
+      "chain": "AB",
+      "number": 1002,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AB.G1002",
+      "shortName": "G",
+      "chi": -165.93034671112113,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 9,
+      "chain": "AB",
+      "number": 1003,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AB.G1003",
+      "shortName": "G",
+      "chi": -121.56524260332266,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 10,
+      "chain": "AB",
+      "number": 1004,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AB.G1004",
+      "shortName": "G",
+      "chi": -156.00957673923347,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 11,
+      "chain": "AB",
+      "number": 1005,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AB.G1005",
+      "shortName": "G",
+      "chi": -148.10051684016406,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 12,
+      "chain": "AB",
+      "number": 1006,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AB.U1006",
+      "shortName": "U",
+      "chi": -137.28005568139977,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 19,
+      "chain": "AC",
+      "number": 1001,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AC.U1001",
+      "shortName": "U",
+      "chi": -141.92671313255747,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 20,
+      "chain": "AC",
+      "number": 1002,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AC.G1002",
+      "shortName": "G",
+      "chi": -165.93034671112116,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 21,
+      "chain": "AC",
+      "number": 1003,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AC.G1003",
+      "shortName": "G",
+      "chi": -121.56524260332266,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 22,
+      "chain": "AC",
+      "number": 1004,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AC.G1004",
+      "shortName": "G",
+      "chi": -156.00957673923352,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 23,
+      "chain": "AC",
+      "number": 1005,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AC.G1005",
+      "shortName": "G",
+      "chi": -148.1005168401641,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 24,
+      "chain": "AC",
+      "number": 1006,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "AC.U1006",
+      "shortName": "U",
+      "chi": -137.28005568139986,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 25,
+      "chain": "B",
+      "number": 2001,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "B.U2001",
+      "shortName": "U",
+      "chi": -146.4615316869476,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 26,
+      "chain": "B",
+      "number": 2002,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "B.G2002",
+      "shortName": "G",
+      "chi": -170.79660912745996,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 27,
+      "chain": "B",
+      "number": 2003,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "B.G2003",
+      "shortName": "G",
+      "chi": -117.68718110874113,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 28,
+      "chain": "B",
+      "number": 2004,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "B.G2004",
+      "shortName": "G",
+      "chi": -153.88587375071324,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 29,
+      "chain": "B",
+      "number": 2005,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "B.G2005",
+      "shortName": "G",
+      "chi": -148.8519912845669,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 30,
+      "chain": "B",
+      "number": 2006,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "B.U2006",
+      "shortName": "U",
+      "chi": -159.43730655241544,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 37,
+      "chain": "BA",
+      "number": 2001,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BA.U2001",
+      "shortName": "U",
+      "chi": -146.46153168694764,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 38,
+      "chain": "BA",
+      "number": 2002,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BA.G2002",
+      "shortName": "G",
+      "chi": -170.79660912745993,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 39,
+      "chain": "BA",
+      "number": 2003,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BA.G2003",
+      "shortName": "G",
+      "chi": -117.68718110874113,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 40,
+      "chain": "BA",
+      "number": 2004,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BA.G2004",
+      "shortName": "G",
+      "chi": -153.88587375071322,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 41,
+      "chain": "BA",
+      "number": 2005,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BA.G2005",
+      "shortName": "G",
+      "chi": -148.851991284567,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 42,
+      "chain": "BA",
+      "number": 2006,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BA.U2006",
+      "shortName": "U",
+      "chi": -159.43730655241544,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 43,
+      "chain": "BB",
+      "number": 2001,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BB.U2001",
+      "shortName": "U",
+      "chi": -146.4615316869476,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 44,
+      "chain": "BB",
+      "number": 2002,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BB.G2002",
+      "shortName": "G",
+      "chi": -170.79660912745993,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 45,
+      "chain": "BB",
+      "number": 2003,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BB.G2003",
+      "shortName": "G",
+      "chi": -117.68718110874106,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 46,
+      "chain": "BB",
+      "number": 2004,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BB.G2004",
+      "shortName": "G",
+      "chi": -153.8858737507132,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 47,
+      "chain": "BB",
+      "number": 2005,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BB.G2005",
+      "shortName": "G",
+      "chi": -148.85199128456696,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 48,
+      "chain": "BB",
+      "number": 2006,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BB.U2006",
+      "shortName": "U",
+      "chi": -159.43730655241544,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 31,
+      "chain": "BC",
+      "number": 2001,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BC.U2001",
+      "shortName": "U",
+      "chi": -146.4615316869476,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 32,
+      "chain": "BC",
+      "number": 2002,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BC.G2002",
+      "shortName": "G",
+      "chi": -170.79660912745993,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 33,
+      "chain": "BC",
+      "number": 2003,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BC.G2003",
+      "shortName": "G",
+      "chi": -117.68718110874121,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 34,
+      "chain": "BC",
+      "number": 2004,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BC.G2004",
+      "shortName": "G",
+      "chi": -153.88587375071322,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 35,
+      "chain": "BC",
+      "number": 2005,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BC.G2005",
+      "shortName": "G",
+      "chi": -148.85199128456694,
+      "glycosidicBond": "anti"
+    },
+    {
+      "index": 36,
+      "chain": "BC",
+      "number": 2006,
+      "icode": null,
+      "molecule": "RNA",
+      "fullName": "BC.U2006",
+      "shortName": "U",
+      "chi": -159.43730655241544,
+      "glycosidicBond": "anti"
+    }
+  ],
+  "basePairs": [
+    {
+      "nt1": "A.G1002",
+      "nt2": "AB.G1002",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "A.G1002",
+      "nt2": "AC.G1002",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "A.G1003",
+      "nt2": "AB.G1003",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "A.G1003",
+      "nt2": "AC.G1003",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "A.G1004",
+      "nt2": "AB.G1004",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "A.G1004",
+      "nt2": "AC.G1004",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "A.G1005",
+      "nt2": "AB.G1005",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "A.G1005",
+      "nt2": "AC.G1005",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "A.U1006",
+      "nt2": "AB.U1006",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "A.U1006",
+      "nt2": "AC.U1006",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "AB.G1002",
+      "nt2": "AA.G1002",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "AA.G1002",
+      "nt2": "AC.G1002",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "AB.G1003",
+      "nt2": "AA.G1003",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "AA.G1003",
+      "nt2": "AC.G1003",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "AB.G1004",
+      "nt2": "AA.G1004",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "AA.G1004",
+      "nt2": "AC.G1004",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "AB.G1005",
+      "nt2": "AA.G1005",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "AA.G1005",
+      "nt2": "AC.G1005",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "AB.U1006",
+      "nt2": "AA.U1006",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "AA.U1006",
+      "nt2": "AC.U1006",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "B.G2002",
+      "nt2": "BB.G2002",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "B.G2002",
+      "nt2": "BC.G2002",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "B.G2003",
+      "nt2": "BB.G2003",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "B.G2003",
+      "nt2": "BC.G2003",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "B.G2004",
+      "nt2": "BB.G2004",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "B.G2004",
+      "nt2": "BC.G2004",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "B.G2005",
+      "nt2": "BB.G2005",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "B.G2005",
+      "nt2": "BC.G2005",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "B.U2006",
+      "nt2": "BB.U2006",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "B.U2006",
+      "nt2": "BC.U2006",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "BA.G2002",
+      "nt2": "BB.G2002",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "BC.G2002",
+      "nt2": "BA.G2002",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "BA.G2003",
+      "nt2": "BB.G2003",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "BC.G2003",
+      "nt2": "BA.G2003",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "BA.G2004",
+      "nt2": "BB.G2004",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "BC.G2004",
+      "nt2": "BA.G2004",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "BA.G2005",
+      "nt2": "BB.G2005",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "BC.G2005",
+      "nt2": "BA.G2005",
+      "lw": "cWH",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "BA.U2006",
+      "nt2": "BB.U2006",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    },
+    {
+      "nt1": "BC.U2006",
+      "nt2": "BA.U2006",
+      "lw": "cHW",
+      "inTetrad": true,
+      "canonical": false
+    }
+  ],
+  "helices": [
+    {
+      "quadruplexes": [
+        {
+          "tetrads": [
+            {
+              "id": "A.U1006-AC.U1006-AA.U1006-AB.U1006",
+              "nt1": "A.U1006",
+              "nt2": "AC.U1006",
+              "nt3": "AA.U1006",
+              "nt4": "AB.U1006",
+              "onz": "O-",
+              "gbaClassification": "VIIIa",
+              "planarityDeviation": 1.061,
+              "ionsChannel": [
+                "NA"
+              ],
+              "ionsOutside": [
+                {
+                  "nt": "A.U1006",
+                  "ion": "SR"
+                },
+                {
+                  "nt": "AA.U1006",
+                  "ion": "SR"
+                },
+                {
+                  "nt": "AB.U1006",
+                  "ion": "SR"
+                },
+                {
+                  "nt": "AC.U1006",
+                  "ion": "SR"
+                }
+              ]
+            },
+            {
+              "id": "A.G1005-AC.G1005-AA.G1005-AB.G1005",
+              "nt1": "A.G1005",
+              "nt2": "AC.G1005",
+              "nt3": "AA.G1005",
+              "nt4": "AB.G1005",
+              "onz": "O+",
+              "gbaClassification": "VIIIa",
+              "planarityDeviation": 0.7999999999999972,
+              "ionsChannel": [],
+              "ionsOutside": []
+            },
+            {
+              "id": "A.G1004-AC.G1004-AA.G1004-AB.G1004",
+              "nt1": "A.G1004",
+              "nt2": "AC.G1004",
+              "nt3": "AA.G1004",
+              "nt4": "AB.G1004",
+              "onz": "O+",
+              "gbaClassification": "VIIIa",
+              "planarityDeviation": 0.4059999999999988,
+              "ionsChannel": [
+                "SR"
+              ],
+              "ionsOutside": []
+            },
+            {
+              "id": "A.G1003-AC.G1003-AA.G1003-AB.G1003",
+              "nt1": "A.G1003",
+              "nt2": "AC.G1003",
+              "nt3": "AA.G1003",
+              "nt4": "AB.G1003",
+              "onz": "O+",
+              "gbaClassification": "VIIIa",
+              "planarityDeviation": 0.5549999999999997,
+              "ionsChannel": [
+                "SR"
+              ],
+              "ionsOutside": []
+            },
+            {
+              "id": "A.G1002-AC.G1002-AA.G1002-AB.G1002",
+              "nt1": "A.G1002",
+              "nt2": "AC.G1002",
+              "nt3": "AA.G1002",
+              "nt4": "AB.G1002",
+              "onz": "O+",
+              "gbaClassification": "VIIIa",
+              "planarityDeviation": 0.541999999999998,
+              "ionsChannel": [],
+              "ionsOutside": [
+                {
+                  "nt": "AB.G1002",
+                  "ion": "CA"
+                },
+                {
+                  "nt": "AC.G1002",
+                  "ion": "CA"
+                },
+                {
+                  "nt": "AA.G1002",
+                  "ion": "CA"
+                },
+                {
+                  "nt": "A.G1002",
+                  "ion": "CA"
+                }
+              ]
+            }
+          ],
+          "onzm": "Op*",
+          "loopClassification": null,
+          "gbaClassification": [
+            "VIII"
+          ],
+          "tracts": [
+            [
+              "A.U1006",
+              "A.G1005",
+              "A.G1004",
+              "A.G1003",
+              "A.G1002"
+            ],
+            [
+              "AC.U1006",
+              "AC.G1005",
+              "AC.G1004",
+              "AC.G1003",
+              "AC.G1002"
+            ],
+            [
+              "AA.U1006",
+              "AA.G1005",
+              "AA.G1004",
+              "AA.G1003",
+              "AA.G1002"
+            ],
+            [
+              "AB.U1006",
+              "AB.G1005",
+              "AB.G1004",
+              "AB.G1003",
+              "AB.G1002"
+            ]
+          ],
+          "loops": []
+        },
+        {
+          "tetrads": [
+            {
+              "id": "B.G2002-BC.G2002-BA.G2002-BB.G2002",
+              "nt1": "B.G2002",
+              "nt2": "BC.G2002",
+              "nt3": "BA.G2002",
+              "nt4": "BB.G2002",
+              "onz": "O+",
+              "gbaClassification": "VIIIa",
+              "planarityDeviation": 0.6730000000000018,
+              "ionsChannel": [],
+              "ionsOutside": []
+            },
+            {
+              "id": "B.G2003-BC.G2003-BA.G2003-BB.G2003",
+              "nt1": "B.G2003",
+              "nt2": "BC.G2003",
+              "nt3": "BA.G2003",
+              "nt4": "BB.G2003",
+              "onz": "O+",
+              "gbaClassification": "VIIIa",
+              "planarityDeviation": 0.5769999999999982,
+              "ionsChannel": [
+                "SR"
+              ],
+              "ionsOutside": [
+                {
+                  "nt": "B.G2003",
+                  "ion": "CA"
+                },
+                {
+                  "nt": "BA.G2003",
+                  "ion": "CA"
+                },
+                {
+                  "nt": "BB.G2003",
+                  "ion": "CA"
+                },
+                {
+                  "nt": "BC.G2003",
+                  "ion": "CA"
+                }
+              ]
+            },
+            {
+              "id": "B.G2004-BC.G2004-BA.G2004-BB.G2004",
+              "nt1": "B.G2004",
+              "nt2": "BC.G2004",
+              "nt3": "BA.G2004",
+              "nt4": "BB.G2004",
+              "onz": "O+",
+              "gbaClassification": "VIIIa",
+              "planarityDeviation": 0.2289999999999992,
+              "ionsChannel": [
+                "SR"
+              ],
+              "ionsOutside": []
+            },
+            {
+              "id": "B.G2005-BC.G2005-BA.G2005-BB.G2005",
+              "nt1": "B.G2005",
+              "nt2": "BC.G2005",
+              "nt3": "BA.G2005",
+              "nt4": "BB.G2005",
+              "onz": "O+",
+              "gbaClassification": "VIIIa",
+              "planarityDeviation": 0.7810000000000006,
+              "ionsChannel": [
+                "NA"
+              ],
+              "ionsOutside": []
+            },
+            {
+              "id": "B.U2006-BC.U2006-BA.U2006-BB.U2006",
+              "nt1": "B.U2006",
+              "nt2": "BC.U2006",
+              "nt3": "BA.U2006",
+              "nt4": "BB.U2006",
+              "onz": "O-",
+              "gbaClassification": "VIIIa",
+              "planarityDeviation": 1.5840000000000005,
+              "ionsChannel": [
+                "NA",
+                "NA"
+              ],
+              "ionsOutside": []
+            }
+          ],
+          "onzm": "Op*",
+          "loopClassification": null,
+          "gbaClassification": [
+            "VIII"
+          ],
+          "tracts": [
+            [
+              "B.G2002",
+              "B.G2003",
+              "B.G2004",
+              "B.G2005",
+              "B.U2006"
+            ],
+            [
+              "BC.G2002",
+              "BC.G2003",
+              "BC.G2004",
+              "BC.G2005",
+              "BC.U2006"
+            ],
+            [
+              "BA.G2002",
+              "BA.G2003",
+              "BA.G2004",
+              "BA.G2005",
+              "BA.U2006"
+            ],
+            [
+              "BB.G2002",
+              "BB.G2003",
+              "BB.G2004",
+              "BB.G2005",
+              "BB.U2006"
+            ]
+          ],
+          "loops": []
+        }
+      ],
+      "tetradPairs": [
+        {
+          "tetrad1": "A.U1006-AC.U1006-AA.U1006-AB.U1006",
+          "tetrad2": "A.G1005-AC.G1005-AA.G1005-AB.G1005",
+          "direction": "parallel",
+          "rise": 3.366499999999995,
+          "twist": 39.962531742191736
+        },
+        {
+          "tetrad1": "A.G1005-AC.G1005-AA.G1005-AB.G1005",
+          "tetrad2": "A.G1004-AC.G1004-AA.G1004-AB.G1004",
+          "direction": "parallel",
+          "rise": 3.308000000000007,
+          "twist": 25.89614444631925
+        },
+        {
+          "tetrad1": "A.G1004-AC.G1004-AA.G1004-AB.G1004",
+          "tetrad2": "A.G1003-AC.G1003-AA.G1003-AB.G1003",
+          "direction": "parallel",
+          "rise": 3.339499999999994,
+          "twist": 35.81115298630443
+        },
+        {
+          "tetrad1": "A.G1003-AC.G1003-AA.G1003-AB.G1003",
+          "tetrad2": "A.G1002-AC.G1002-AA.G1002-AB.G1002",
+          "direction": "parallel",
+          "rise": 3.2865,
+          "twist": 27.11515971986803
+        },
+        {
+          "tetrad1": "A.G1002-AC.G1002-AA.G1002-AB.G1002",
+          "tetrad2": "B.G2002-BC.G2002-BA.G2002-BB.G2002",
+          "direction": "parallel",
+          "rise": 3.369500000000002,
+          "twist": 28.993180312675573
+        },
+        {
+          "tetrad1": "B.G2002-BC.G2002-BA.G2002-BB.G2002",
+          "tetrad2": "B.G2003-BC.G2003-BA.G2003-BB.G2003",
+          "direction": "parallel",
+          "rise": 3.371000000000002,
+          "twist": 27.410084968596852
+        },
+        {
+          "tetrad1": "B.G2003-BC.G2003-BA.G2003-BB.G2003",
+          "tetrad2": "B.G2004-BC.G2004-BA.G2004-BB.G2004",
+          "direction": "parallel",
+          "rise": 3.318000000000005,
+          "twist": 35.04072146975963
+        },
+        {
+          "tetrad1": "B.G2004-BC.G2004-BA.G2004-BB.G2004",
+          "tetrad2": "B.G2005-BC.G2005-BA.G2005-BB.G2005",
+          "direction": "parallel",
+          "rise": 3.2689999999999966,
+          "twist": 25.149997949938147
+        },
+        {
+          "tetrad1": "B.G2005-BC.G2005-BA.G2005-BB.G2005",
+          "tetrad2": "B.U2006-BC.U2006-BA.U2006-BB.U2006",
+          "direction": "parallel",
+          "rise": 7.140499999999998,
+          "twist": 43.40609492262336
+        }
+      ]
+    }
+  ],
+  "dotBracket": {
+    "sequence": "UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU",
+    "line1": ".([{<A-.([{<A-.)]}>a-.)]}>a-.([{<A-.)]}>a-.([{<A-.)]}>a",
+    "line2": ".([{<A-.)]}>a-.([{<A-.)]}>a-.([{<A-.([{<A-.)]}>a-.)]}>a"
+  }
+}
+```
+
+</details>
+
+# Funding
+
+This research was supported by the National Science Centre, Poland
+\[2016/23/B/ST6/03931, 2019/35/B/ST6/03074\] and Mloda Kadra project
+\[09/91/SBAD/0684\] from Poznan University of Technology, and carried
+out in the European Centre for Bioinformatics and Genomics (Poland). The
+authors also acknowledge partial support by the statutory funds of
+Poznan University of Technology, Polish Ministry of Science and Higher
+Education, and the Institute of Bioorganic Chemistry, PAS within
+intramural financing program.
+
+# Bibliography
+
+<div id="refs" class="references csl-bib-body">
+
+1.  Topology-Based Classification of Tetrads and Quadruplex
+    Structures. M. Popenda, J. Miskiewicz, J. Sarzynska, T. Zok, M.
+    Szachniuk. *Bioinformatics*. 2020. 36(4):1129–1134.
+    doi:[10.1093/bioinformatics/btz738](https://doi.org/10.1093/bioinformatics/btz738)
+
+2.  ElTetrado: A Tool for Identification and Classification of Tetrads
+    and Quadruplexes. T. Zok, M. Popenda, M. Szachniuk. *BMC
+    Bioinformatics*. 2020. 21(1):40.
+    doi:[10.1186/s12859-020-3385-1](https://doi.org/10.1186/s12859-020-3385-1)
+
+3.  R-Chie : A Web Server and R Package for Visualizing RNA Secondary
+    Structures. D. Lai, J.R. Proctor, J.Y.A. Zhu, I.M. Meyer. *Nucleic
+    Acids Research*. 2012. 40(12):e95.
+    doi:[f99845](https://doi.org/f99845)
+
+4.  Geometric Nomenclature and Classification of RNA Base Pairs. N.B.
+    Leontis, E. Westhof. *RNA*. 2001. 7(4):499–512.
+    doi:[10.1017/s1355838201002515](https://doi.org/10.1017/s1355838201002515)
+
+</div>
+
+
+%prep
+%autosetup -n eltetrado-1.5.15
+
+%build
+%py3_build
+
+%install
+%py3_install
+install -d -m755 %{buildroot}/%{_pkgdocdir}
+if [ -d doc ]; then cp -arf doc %{buildroot}/%{_pkgdocdir}; fi
+if [ -d docs ]; then cp -arf docs %{buildroot}/%{_pkgdocdir}; fi
+if [ -d example ]; then cp -arf example %{buildroot}/%{_pkgdocdir}; fi
+if [ -d examples ]; then cp -arf examples %{buildroot}/%{_pkgdocdir}; fi
+pushd %{buildroot}
+if [ -d usr/lib ]; then
+	find usr/lib -type f -printf "/%h/%f\n" >> filelist.lst
+fi
+if [ -d usr/lib64 ]; then
+	find usr/lib64 -type f -printf "/%h/%f\n" >> filelist.lst
+fi
+if [ -d usr/bin ]; then
+	find usr/bin -type f -printf "/%h/%f\n" >> filelist.lst
+fi
+if [ -d usr/sbin ]; then
+	find usr/sbin -type f -printf "/%h/%f\n" >> filelist.lst
+fi
+touch doclist.lst
+if [ -d usr/share/man ]; then
+	find usr/share/man -type f -printf "/%h/%f.gz\n" >> doclist.lst
+fi
+popd
+mv %{buildroot}/filelist.lst .
+mv %{buildroot}/doclist.lst .
+
+%files -n python3-eltetrado -f filelist.lst
+%dir %{python3_sitelib}/*
+
+%files help -f doclist.lst
+%{_docdir}/*
+
+%changelog
+* Mon May 29 2023 Python_Bot <Python_Bot@openeuler.org> - 1.5.15-1
+- Package Spec generated
diff --git a/sources b/sources
new file mode 100644
index 0000000..5843887
--- /dev/null
+++ b/sources
@@ -0,0 +1 @@
+bd3197e3a59cc083882efafc4529d14f  eltetrado-1.5.15.tar.gz
-- 
cgit v1.2.3