summaryrefslogtreecommitdiff
diff options
context:
space:
mode:
authorCoprDistGit <infra@openeuler.org>2023-05-29 12:47:59 +0000
committerCoprDistGit <infra@openeuler.org>2023-05-29 12:47:59 +0000
commit5b0cdabca920e2e57ebb206eb0895d5dd465e826 (patch)
tree234b8c8a9a10e4ddd576cee93d9f6ee5cd3a4d5e
parent49c055aee07319b8198f59c6c8153ddf3a450620 (diff)
automatic import of python-eltetrado
-rw-r--r--.gitignore1
-rw-r--r--python-eltetrado.spec5896
-rw-r--r--sources1
3 files changed, 5898 insertions, 0 deletions
diff --git a/.gitignore b/.gitignore
index e69de29..7b00e7c 100644
--- a/.gitignore
+++ b/.gitignore
@@ -0,0 +1 @@
+/eltetrado-1.5.15.tar.gz
diff --git a/python-eltetrado.spec b/python-eltetrado.spec
new file mode 100644
index 0000000..25ac544
--- /dev/null
+++ b/python-eltetrado.spec
@@ -0,0 +1,5896 @@
+%global _empty_manifest_terminate_build 0
+Name: python-eltetrado
+Version: 1.5.15
+Release: 1
+Summary: Find and classify tetrads and quadruplexes in DNA/RNA 3D structure
+License: MIT License
+URL: https://github.com/tzok/eltetrado
+Source0: https://mirrors.nju.edu.cn/pypi/web/packages/63/a5/eade5c2ccfa45c110468f91e98191b35be42e29ae1c243db07e35d3717ce/eltetrado-1.5.15.tar.gz
+BuildArch: noarch
+
+Requires: python3-mmcif
+Requires: python3-numpy
+Requires: python3-orjson
+Requires: python3-rnapolis
+
+%description
+![](logo.svg)
+
+# Project description
+
+This is an application to analyze base pairing patterns of DNA/RNA 3D
+structures to find and classify tetrads and quadruplexes. ElTetrado
+assigns tetrads to one of the ONZ classes (O, N, Z) alongside with the
+directionality of the tetrad (+/-) determined by the bonds between bases
+and their non-canonical interactions. The interactions follow
+Leontis/Westhof classification (Leontis *et al.* 2001). Watson-Crick (W)
+edge of first base in the tetrad structure exposed to the Hoogsteen (H)
+edge of the next nucleobase from the same tetrad sets the tetrad
+directionality, clockwise (+) or anticlockwise (-). For more details,
+please refer to Zok *et al.* (2020) and Popenda *et al.* (2020)
+
+# Installation
+
+Please run:
+
+ pip install eltetrado
+
+If you have both Python 2 and Python 3 installed, you need to explicitly
+call `pip3`:
+
+ pip3 install eltetrado
+
+# Dependencies
+
+The project is written in Python 3.6+ and requires
+[mmcif](https://pypi.org/project/mmcif/),
+[orjson](https://github.com/ijl/orjson), [NumPy](https://numpy.org/) and
+[requests](https://docs.python-requests.org/en/latest/).
+
+Visualization is created by `R` 3.6+ script which uses
+[R4RNA](https://www.e-rna.org/r-chie/) (Lai *et al.* 2012) library. The
+dependency will be automatically installed if not present.
+
+Base pairs and stacking interactions are identified by
+[RNApolis](https://github.com/tzok/rnapolis-py).
+
+# Usage
+
+ElTetrado is a command line application, which requires to be provided
+with `--input` and a path to a PDB or PDBx/mmCIF file.
+
+By default, ElTetrado outputs textual results on the standard output. A
+JSON version of the output can be obtained with `--output` switch
+followed by a path where the file is supposed to be created.
+
+ElTetrado prepares visualization of the whole structure and of each
+N4-helices, quadruplexes and tetrads. This can be supplemented with
+canonical base pairs visualization when `--complete-2d` is set. All
+color settings are located in the first several lines of the `quadraw.R`
+file, you can easily change them without knowledge of R language. If you
+want ElTetrado to not visualize anything, pass `--no-image` switch to
+it.
+
+ usage: eltetrado [-h] [-i INPUT] [-o OUTPUT] [-m MODEL]
+ [--stacking-mismatch STACKING_MISMATCH] [--strict]
+ [--no-reorder] [--complete-2d] [--no-image]
+ [--dssr-json DSSR_JSON] [-v]
+
+ options:
+ -h, --help show this help message and exit
+ -i INPUT, --input INPUT
+ path to input PDB or PDBx/mmCIF file
+ -o OUTPUT, --output OUTPUT
+ (optional) path for output JSON file
+ -m MODEL, --model MODEL
+ (optional) model number to process
+ --stacking-mismatch STACKING_MISMATCH
+ a perfect tetrad stacking covers 4 nucleotides; this
+ option can be used with value 1 or 2 to allow this
+ number of nucleotides to be non-stacked with otherwise
+ well aligned tetrad [default=2]
+ --strict nucleotides in tetrad are found when linked only by
+ cWH pairing
+ --no-reorder chains of bi- and tetramolecular quadruplexes should
+ be reordered to be able to have them classified; when
+ this is set, chains will be processed in original
+ order, which for bi-/tetramolecular means that they
+ will likely be misclassified; use with care!
+ --complete-2d when set, the visualization will also show canonical
+ base pairs to provide context for the quadruplex
+ --no-image when set, the visualization will not be created at all
+ --dssr-json DSSR_JSON
+ (optional) provide a JSON file generated by DSSR to
+ read the secondary structure information from (use
+ --nmr and --json switches)
+ -v, --version show program's version number and exit
+
+# Chains reorder
+
+ElTetrado keeps a global and unique 5’-3’ index for every nucleotide
+which is independent from residue numbers. For example, if a structure
+has chain M with 60 nucleotides and chain N with 15 nucleotides, then
+ElTetrado will keep index between 0 and 74 which uniquely identifies
+every nucleotide. Initially, ElTetrado assigns this indices according to
+the order of chains in the input file. Therefore, if M preceded N then
+nucleotides in M will be indexed from 0 to 59 and in N from 60 to 74.
+Otherwise, nucleotides in N will be indexed from 0 to 14 and in M from
+15 to 74.
+
+When `--no-reorder` is present, this initial assignment is used.
+Otherwise, ElTetrado exhaustively checks all permutations of chains’
+orders. Every permutation check induces recalculation of the global and
+unique 5’-3’ index and in effect it changes ONZ classification of
+tetrads.
+
+ElTetrado keeps a table of tetrad classification scores according to
+these rules:
+
+- Type preference: `O` \> `N` \> `Z`
+- Direction preference: `+` \> `-`
+
+The table keeps low values for preferred classes i.e. `O+` is 0, `O-` is
+1 and so on up to `Z-` with score 5. For every permutation of chain
+orders, ElTetrado computes sum of scores for tetrads classification
+induced by 5’-3’ indexing. We select permutation with the minimum value.
+
+# Examples
+
+## 2HY9: Human telomere DNA quadruplex structure in K+ solution hybrid-1 form
+
+![](2hy9.png)
+
+ $ curl ftp://ftp.wwpdb.org/pub/pdb/data/structures/divided/mmCIF/my/2hy9.cif.gz | gzip -d > 2hy9.cif
+ $ ./eltetrado --input 2hy9.cif --output 2hy9.json
+
+ Chain order: 1
+ n4-helix with 3 tetrads
+ Oh* V,VI 9a -(pll) quadruplex with 3 tetrads
+ 1.DG4 1.DG22 1.DG18 1.DG10 cWH cWH cWH cWH O- Vb planarity=0.17
+ direction=hybrid rise=3.21 twist=16.23
+ 1.DG5 1.DG23 1.DG17 1.DG11 cHW cHW cHW cHW O+ Va planarity=0.1
+ direction=hybrid rise=3.11 twist=27.45
+ 1.DG6 1.DG24 1.DG16 1.DG12 cHW cHW cHW cHW O+ VIa planarity=0.18
+
+ Tracts:
+ 1.DG4, 1.DG5, 1.DG6
+ 1.DG22, 1.DG23, 1.DG24
+ 1.DG18, 1.DG17, 1.DG16
+ 1.DG10, 1.DG11, 1.DG12
+
+ Loops:
+ propeller- 1.DT7, 1.DT8, 1.DA9
+ lateral- 1.DT13, 1.DT14, 1.DA15
+ lateral+ 1.DT19, 1.DT20, 1.DA21
+
+ AAAGGGTTAGGGTTAGGGTTAGGGAA
+ ...([{...(((...)))...)]}..
+ ...([{...)]}...(((...)))..
+
+<details>
+<summary>
+Click to see the output JSON
+</summary>
+
+``` json
+{
+ "metals": [],
+ "nucleotides": [
+ {
+ "index": 1,
+ "chain": "1",
+ "number": 1,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DA1",
+ "shortName": "A",
+ "chi": 22.308282830857802,
+ "glycosidicBond": "syn"
+ },
+ {
+ "index": 2,
+ "chain": "1",
+ "number": 2,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DA2",
+ "shortName": "A",
+ "chi": -123.05454402191421,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 3,
+ "chain": "1",
+ "number": 3,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DA3",
+ "shortName": "A",
+ "chi": -94.96579955603106,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 4,
+ "chain": "1",
+ "number": 4,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DG4",
+ "shortName": "G",
+ "chi": 79.28363721639316,
+ "glycosidicBond": "syn"
+ },
+ {
+ "index": 5,
+ "chain": "1",
+ "number": 5,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DG5",
+ "shortName": "G",
+ "chi": -126.01709201555563,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 6,
+ "chain": "1",
+ "number": 6,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DG6",
+ "shortName": "G",
+ "chi": -127.26656202302102,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 7,
+ "chain": "1",
+ "number": 7,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DT7",
+ "shortName": "T",
+ "chi": -63.10830751967371,
+ "glycosidicBond": "syn"
+ },
+ {
+ "index": 8,
+ "chain": "1",
+ "number": 8,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DT8",
+ "shortName": "T",
+ "chi": -138.79520345559828,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 9,
+ "chain": "1",
+ "number": 9,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DA9",
+ "shortName": "A",
+ "chi": -148.83990757408878,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 10,
+ "chain": "1",
+ "number": 10,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DG10",
+ "shortName": "G",
+ "chi": 58.7787525019158,
+ "glycosidicBond": "syn"
+ },
+ {
+ "index": 11,
+ "chain": "1",
+ "number": 11,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DG11",
+ "shortName": "G",
+ "chi": -123.85746807924986,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 12,
+ "chain": "1",
+ "number": 12,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DG12",
+ "shortName": "G",
+ "chi": -84.36679807284759,
+ "glycosidicBond": "syn"
+ },
+ {
+ "index": 13,
+ "chain": "1",
+ "number": 13,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DT13",
+ "shortName": "T",
+ "chi": -30.819029132834157,
+ "glycosidicBond": "syn"
+ },
+ {
+ "index": 14,
+ "chain": "1",
+ "number": 14,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DT14",
+ "shortName": "T",
+ "chi": -168.51776782812965,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 15,
+ "chain": "1",
+ "number": 15,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DA15",
+ "shortName": "A",
+ "chi": -105.72881577106517,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 16,
+ "chain": "1",
+ "number": 16,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DG16",
+ "shortName": "G",
+ "chi": 74.3227942181243,
+ "glycosidicBond": "syn"
+ },
+ {
+ "index": 17,
+ "chain": "1",
+ "number": 17,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DG17",
+ "shortName": "G",
+ "chi": 81.08424926936044,
+ "glycosidicBond": "syn"
+ },
+ {
+ "index": 18,
+ "chain": "1",
+ "number": 18,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DG18",
+ "shortName": "G",
+ "chi": -122.90397217111551,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 19,
+ "chain": "1",
+ "number": 19,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DT19",
+ "shortName": "T",
+ "chi": -102.98239337113938,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 20,
+ "chain": "1",
+ "number": 20,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DT20",
+ "shortName": "T",
+ "chi": -112.1514601849715,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 21,
+ "chain": "1",
+ "number": 21,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DA21",
+ "shortName": "A",
+ "chi": -89.07113063649612,
+ "glycosidicBond": "syn"
+ },
+ {
+ "index": 22,
+ "chain": "1",
+ "number": 22,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DG22",
+ "shortName": "G",
+ "chi": 83.44318693001902,
+ "glycosidicBond": "syn"
+ },
+ {
+ "index": 23,
+ "chain": "1",
+ "number": 23,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DG23",
+ "shortName": "G",
+ "chi": -115.41210237198398,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 24,
+ "chain": "1",
+ "number": 24,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DG24",
+ "shortName": "G",
+ "chi": -111.14845782593531,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 25,
+ "chain": "1",
+ "number": 25,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DA25",
+ "shortName": "A",
+ "chi": -58.323530637551954,
+ "glycosidicBond": "syn"
+ },
+ {
+ "index": 26,
+ "chain": "1",
+ "number": 26,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DA26",
+ "shortName": "A",
+ "chi": -90.84065243137135,
+ "glycosidicBond": "anti"
+ }
+ ],
+ "basePairs": [
+ {
+ "nt1": "1.DA3",
+ "nt2": "1.DA21",
+ "lw": "cHW",
+ "inTetrad": false,
+ "canonical": false
+ },
+ {
+ "nt1": "1.DG4",
+ "nt2": "1.DG10",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "1.DG4",
+ "nt2": "1.DG22",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "1.DG5",
+ "nt2": "1.DG11",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "1.DG5",
+ "nt2": "1.DG23",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "1.DG6",
+ "nt2": "1.DG12",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "1.DG6",
+ "nt2": "1.DG24",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "1.DG10",
+ "nt2": "1.DG18",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "1.DG11",
+ "nt2": "1.DG17",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "1.DG12",
+ "nt2": "1.DG16",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "1.DT14",
+ "nt2": "1.DA25",
+ "lw": "tWW",
+ "inTetrad": false,
+ "canonical": false
+ },
+ {
+ "nt1": "1.DG16",
+ "nt2": "1.DG24",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "1.DG17",
+ "nt2": "1.DG23",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "1.DG18",
+ "nt2": "1.DG22",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ }
+ ],
+ "helices": [
+ {
+ "quadruplexes": [
+ {
+ "tetrads": [
+ {
+ "id": "1.DG4-1.DG22-1.DG18-1.DG10",
+ "nt1": "1.DG4",
+ "nt2": "1.DG22",
+ "nt3": "1.DG18",
+ "nt4": "1.DG10",
+ "onz": "O-",
+ "gbaClassification": "Vb",
+ "planarityDeviation": 0.17372283960377805,
+ "ionsChannel": [],
+ "ionsOutside": []
+ },
+ {
+ "id": "1.DG5-1.DG23-1.DG17-1.DG11",
+ "nt1": "1.DG5",
+ "nt2": "1.DG23",
+ "nt3": "1.DG17",
+ "nt4": "1.DG11",
+ "onz": "O+",
+ "gbaClassification": "Va",
+ "planarityDeviation": 0.10474313820007483,
+ "ionsChannel": [],
+ "ionsOutside": []
+ },
+ {
+ "id": "1.DG6-1.DG24-1.DG16-1.DG12",
+ "nt1": "1.DG6",
+ "nt2": "1.DG24",
+ "nt3": "1.DG16",
+ "nt4": "1.DG12",
+ "onz": "O+",
+ "gbaClassification": "VIa",
+ "planarityDeviation": 0.18293509778060615,
+ "ionsChannel": [],
+ "ionsOutside": []
+ }
+ ],
+ "onzm": "Oh*",
+ "loopClassification": {
+ "classification": "9a",
+ "loopProgression": "-(pll)"
+ },
+ "gbaClassification": [
+ "V",
+ "VI"
+ ],
+ "tracts": [
+ [
+ "1.DG4",
+ "1.DG5",
+ "1.DG6"
+ ],
+ [
+ "1.DG22",
+ "1.DG23",
+ "1.DG24"
+ ],
+ [
+ "1.DG18",
+ "1.DG17",
+ "1.DG16"
+ ],
+ [
+ "1.DG10",
+ "1.DG11",
+ "1.DG12"
+ ]
+ ],
+ "loops": [
+ {
+ "type": "propeller-",
+ "nucleotides": [
+ "1.DT7",
+ "1.DT8",
+ "1.DA9"
+ ]
+ },
+ {
+ "type": "lateral-",
+ "nucleotides": [
+ "1.DT13",
+ "1.DT14",
+ "1.DA15"
+ ]
+ },
+ {
+ "type": "lateral+",
+ "nucleotides": [
+ "1.DT19",
+ "1.DT20",
+ "1.DA21"
+ ]
+ }
+ ]
+ }
+ ],
+ "tetradPairs": [
+ {
+ "tetrad1": "1.DG4-1.DG22-1.DG18-1.DG10",
+ "tetrad2": "1.DG5-1.DG23-1.DG17-1.DG11",
+ "direction": "hybrid",
+ "rise": 3.2109650905140654,
+ "twist": 16.228973729066034
+ },
+ {
+ "tetrad1": "1.DG5-1.DG23-1.DG17-1.DG11",
+ "tetrad2": "1.DG6-1.DG24-1.DG16-1.DG12",
+ "direction": "hybrid",
+ "rise": 3.1149939255558747,
+ "twist": 27.448958336697046
+ }
+ ]
+ }
+ ],
+ "dotBracket": {
+ "sequence": "AAAGGGTTAGGGTTAGGGTTAGGGAA",
+ "line1": "...([{...(((...)))...)]}..",
+ "line2": "...([{...)]}...(((...))).."
+ }
+}
+```
+
+</details>
+
+## 4RJ1: Structural variations and solvent structure of UGGGGU quadruplexes stabilized by Sr2+ ions
+
+![](4rj1.png)
+
+ $ curl https://www.ebi.ac.uk/pdbe/static/entry/download/4rj1-assembly-1.cif.gz | gzip -d > 4rj1-1.cif
+ $ ./eltetrado --input 4rj1-1.cif --output 4rj1-1.json
+
+ Chain order: A AB AA AC B BC BA BB
+ n4-helix with 10 tetrads
+ Op* VIII n/a quadruplex with 5 tetrads
+ A.U1006 AC.U1006 AA.U1006 AB.U1006 cWH cWH cWH cWH O- VIIIa planarity=1.06 ions_channel=NA ions_outside=A.U1006: [SR] AA.U1006: [SR] AB.U1006: [SR] AC.U1006: [SR]
+ direction=parallel rise=3.37 twist=39.96
+ A.G1005 AC.G1005 AA.G1005 AB.G1005 cHW cHW cHW cHW O+ VIIIa planarity=0.8
+ direction=parallel rise=3.31 twist=25.9
+ A.G1004 AC.G1004 AA.G1004 AB.G1004 cHW cHW cHW cHW O+ VIIIa planarity=0.41 ions_channel=SR
+ direction=parallel rise=3.34 twist=35.81
+ A.G1003 AC.G1003 AA.G1003 AB.G1003 cHW cHW cHW cHW O+ VIIIa planarity=0.55 ions_channel=SR
+ direction=parallel rise=3.29 twist=27.12
+ A.G1002 AC.G1002 AA.G1002 AB.G1002 cHW cHW cHW cHW O+ VIIIa planarity=0.54 ions_outside=AB.G1002: [CA] AC.G1002: [CA] AA.G1002: [CA] A.G1002: [CA]
+
+ Tracts:
+ A.U1006, A.G1005, A.G1004, A.G1003, A.G1002
+ AC.U1006, AC.G1005, AC.G1004, AC.G1003, AC.G1002
+ AA.U1006, AA.G1005, AA.G1004, AA.G1003, AA.G1002
+ AB.U1006, AB.G1005, AB.G1004, AB.G1003, AB.G1002
+
+ Op* VIII n/a quadruplex with 5 tetrads
+ B.G2002 BC.G2002 BA.G2002 BB.G2002 cWH cWH cWH cWH O+ VIIIa planarity=0.67
+ direction=parallel rise=3.37 twist=27.41
+ B.G2003 BC.G2003 BA.G2003 BB.G2003 cWH cWH cWH cWH O+ VIIIa planarity=0.58 ions_channel=SR ions_outside=B.G2003: [CA] BA.G2003: [CA] BB.G2003: [CA] BC.G2003: [CA]
+ direction=parallel rise=3.32 twist=35.04
+ B.G2004 BC.G2004 BA.G2004 BB.G2004 cWH cWH cWH cWH O+ VIIIa planarity=0.23 ions_channel=SR
+ direction=parallel rise=3.27 twist=25.15
+ B.G2005 BC.G2005 BA.G2005 BB.G2005 cWH cWH cWH cWH O+ VIIIa planarity=0.78 ions_channel=NA
+ direction=parallel rise=7.14 twist=43.41
+ B.U2006 BC.U2006 BA.U2006 BB.U2006 cHW cHW cHW cHW O- VIIIa planarity=1.58 ions_channel=NA,NA
+
+ Tracts:
+ B.G2002, B.G2003, B.G2004, B.G2005, B.U2006
+ BC.G2002, BC.G2003, BC.G2004, BC.G2005, BC.U2006
+ BA.G2002, BA.G2003, BA.G2004, BA.G2005, BA.U2006
+ BB.G2002, BB.G2003, BB.G2004, BB.G2005, BB.U2006
+
+ UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU
+ .([{<A-.([{<A-.)]}>a-.)]}>a-.([{<A-.)]}>a-.([{<A-.)]}>a
+ .([{<A-.)]}>a-.([{<A-.)]}>a-.([{<A-.([{<A-.)]}>a-.)]}>a
+
+<details>
+<summary>
+Click to see the output JSON
+</summary>
+
+``` json
+{
+ "metals": [
+ {
+ "symbol": "Sr",
+ "count": 8
+ },
+ {
+ "symbol": "Na",
+ "count": 4
+ },
+ {
+ "symbol": "Ca",
+ "count": 12
+ }
+ ],
+ "nucleotides": [
+ {
+ "index": 1,
+ "chain": "A",
+ "number": 1001,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "A.U1001",
+ "shortName": "U",
+ "chi": -141.92671313255752,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 2,
+ "chain": "A",
+ "number": 1002,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "A.G1002",
+ "shortName": "G",
+ "chi": -165.93034671112116,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 3,
+ "chain": "A",
+ "number": 1003,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "A.G1003",
+ "shortName": "G",
+ "chi": -121.5652426033226,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 4,
+ "chain": "A",
+ "number": 1004,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "A.G1004",
+ "shortName": "G",
+ "chi": -156.00957673923344,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 5,
+ "chain": "A",
+ "number": 1005,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "A.G1005",
+ "shortName": "G",
+ "chi": -148.10051684016415,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 6,
+ "chain": "A",
+ "number": 1006,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "A.U1006",
+ "shortName": "U",
+ "chi": -137.28005568139983,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 13,
+ "chain": "AA",
+ "number": 1001,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AA.U1001",
+ "shortName": "U",
+ "chi": -141.9267131325575,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 14,
+ "chain": "AA",
+ "number": 1002,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AA.G1002",
+ "shortName": "G",
+ "chi": -165.93034671112113,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 15,
+ "chain": "AA",
+ "number": 1003,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AA.G1003",
+ "shortName": "G",
+ "chi": -121.56524260332266,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 16,
+ "chain": "AA",
+ "number": 1004,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AA.G1004",
+ "shortName": "G",
+ "chi": -156.0095767392335,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 17,
+ "chain": "AA",
+ "number": 1005,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AA.G1005",
+ "shortName": "G",
+ "chi": -148.10051684016406,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 18,
+ "chain": "AA",
+ "number": 1006,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AA.U1006",
+ "shortName": "U",
+ "chi": -137.2800556813998,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 7,
+ "chain": "AB",
+ "number": 1001,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AB.U1001",
+ "shortName": "U",
+ "chi": -141.9267131325574,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 8,
+ "chain": "AB",
+ "number": 1002,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AB.G1002",
+ "shortName": "G",
+ "chi": -165.93034671112113,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 9,
+ "chain": "AB",
+ "number": 1003,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AB.G1003",
+ "shortName": "G",
+ "chi": -121.56524260332266,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 10,
+ "chain": "AB",
+ "number": 1004,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AB.G1004",
+ "shortName": "G",
+ "chi": -156.00957673923347,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 11,
+ "chain": "AB",
+ "number": 1005,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AB.G1005",
+ "shortName": "G",
+ "chi": -148.10051684016406,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 12,
+ "chain": "AB",
+ "number": 1006,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AB.U1006",
+ "shortName": "U",
+ "chi": -137.28005568139977,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 19,
+ "chain": "AC",
+ "number": 1001,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AC.U1001",
+ "shortName": "U",
+ "chi": -141.92671313255747,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 20,
+ "chain": "AC",
+ "number": 1002,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AC.G1002",
+ "shortName": "G",
+ "chi": -165.93034671112116,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 21,
+ "chain": "AC",
+ "number": 1003,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AC.G1003",
+ "shortName": "G",
+ "chi": -121.56524260332266,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 22,
+ "chain": "AC",
+ "number": 1004,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AC.G1004",
+ "shortName": "G",
+ "chi": -156.00957673923352,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 23,
+ "chain": "AC",
+ "number": 1005,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AC.G1005",
+ "shortName": "G",
+ "chi": -148.1005168401641,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 24,
+ "chain": "AC",
+ "number": 1006,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AC.U1006",
+ "shortName": "U",
+ "chi": -137.28005568139986,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 25,
+ "chain": "B",
+ "number": 2001,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "B.U2001",
+ "shortName": "U",
+ "chi": -146.4615316869476,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 26,
+ "chain": "B",
+ "number": 2002,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "B.G2002",
+ "shortName": "G",
+ "chi": -170.79660912745996,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 27,
+ "chain": "B",
+ "number": 2003,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "B.G2003",
+ "shortName": "G",
+ "chi": -117.68718110874113,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 28,
+ "chain": "B",
+ "number": 2004,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "B.G2004",
+ "shortName": "G",
+ "chi": -153.88587375071324,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 29,
+ "chain": "B",
+ "number": 2005,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "B.G2005",
+ "shortName": "G",
+ "chi": -148.8519912845669,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 30,
+ "chain": "B",
+ "number": 2006,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "B.U2006",
+ "shortName": "U",
+ "chi": -159.43730655241544,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 37,
+ "chain": "BA",
+ "number": 2001,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BA.U2001",
+ "shortName": "U",
+ "chi": -146.46153168694764,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 38,
+ "chain": "BA",
+ "number": 2002,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BA.G2002",
+ "shortName": "G",
+ "chi": -170.79660912745993,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 39,
+ "chain": "BA",
+ "number": 2003,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BA.G2003",
+ "shortName": "G",
+ "chi": -117.68718110874113,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 40,
+ "chain": "BA",
+ "number": 2004,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BA.G2004",
+ "shortName": "G",
+ "chi": -153.88587375071322,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 41,
+ "chain": "BA",
+ "number": 2005,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BA.G2005",
+ "shortName": "G",
+ "chi": -148.851991284567,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 42,
+ "chain": "BA",
+ "number": 2006,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BA.U2006",
+ "shortName": "U",
+ "chi": -159.43730655241544,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 43,
+ "chain": "BB",
+ "number": 2001,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BB.U2001",
+ "shortName": "U",
+ "chi": -146.4615316869476,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 44,
+ "chain": "BB",
+ "number": 2002,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BB.G2002",
+ "shortName": "G",
+ "chi": -170.79660912745993,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 45,
+ "chain": "BB",
+ "number": 2003,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BB.G2003",
+ "shortName": "G",
+ "chi": -117.68718110874106,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 46,
+ "chain": "BB",
+ "number": 2004,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BB.G2004",
+ "shortName": "G",
+ "chi": -153.8858737507132,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 47,
+ "chain": "BB",
+ "number": 2005,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BB.G2005",
+ "shortName": "G",
+ "chi": -148.85199128456696,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 48,
+ "chain": "BB",
+ "number": 2006,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BB.U2006",
+ "shortName": "U",
+ "chi": -159.43730655241544,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 31,
+ "chain": "BC",
+ "number": 2001,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BC.U2001",
+ "shortName": "U",
+ "chi": -146.4615316869476,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 32,
+ "chain": "BC",
+ "number": 2002,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BC.G2002",
+ "shortName": "G",
+ "chi": -170.79660912745993,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 33,
+ "chain": "BC",
+ "number": 2003,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BC.G2003",
+ "shortName": "G",
+ "chi": -117.68718110874121,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 34,
+ "chain": "BC",
+ "number": 2004,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BC.G2004",
+ "shortName": "G",
+ "chi": -153.88587375071322,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 35,
+ "chain": "BC",
+ "number": 2005,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BC.G2005",
+ "shortName": "G",
+ "chi": -148.85199128456694,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 36,
+ "chain": "BC",
+ "number": 2006,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BC.U2006",
+ "shortName": "U",
+ "chi": -159.43730655241544,
+ "glycosidicBond": "anti"
+ }
+ ],
+ "basePairs": [
+ {
+ "nt1": "A.G1002",
+ "nt2": "AB.G1002",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "A.G1002",
+ "nt2": "AC.G1002",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "A.G1003",
+ "nt2": "AB.G1003",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "A.G1003",
+ "nt2": "AC.G1003",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "A.G1004",
+ "nt2": "AB.G1004",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "A.G1004",
+ "nt2": "AC.G1004",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "A.G1005",
+ "nt2": "AB.G1005",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "A.G1005",
+ "nt2": "AC.G1005",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "A.U1006",
+ "nt2": "AB.U1006",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "A.U1006",
+ "nt2": "AC.U1006",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "AB.G1002",
+ "nt2": "AA.G1002",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "AA.G1002",
+ "nt2": "AC.G1002",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "AB.G1003",
+ "nt2": "AA.G1003",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "AA.G1003",
+ "nt2": "AC.G1003",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "AB.G1004",
+ "nt2": "AA.G1004",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "AA.G1004",
+ "nt2": "AC.G1004",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "AB.G1005",
+ "nt2": "AA.G1005",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "AA.G1005",
+ "nt2": "AC.G1005",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "AB.U1006",
+ "nt2": "AA.U1006",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "AA.U1006",
+ "nt2": "AC.U1006",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "B.G2002",
+ "nt2": "BB.G2002",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "B.G2002",
+ "nt2": "BC.G2002",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "B.G2003",
+ "nt2": "BB.G2003",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "B.G2003",
+ "nt2": "BC.G2003",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "B.G2004",
+ "nt2": "BB.G2004",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "B.G2004",
+ "nt2": "BC.G2004",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "B.G2005",
+ "nt2": "BB.G2005",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "B.G2005",
+ "nt2": "BC.G2005",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "B.U2006",
+ "nt2": "BB.U2006",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "B.U2006",
+ "nt2": "BC.U2006",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "BA.G2002",
+ "nt2": "BB.G2002",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "BC.G2002",
+ "nt2": "BA.G2002",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "BA.G2003",
+ "nt2": "BB.G2003",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "BC.G2003",
+ "nt2": "BA.G2003",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "BA.G2004",
+ "nt2": "BB.G2004",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "BC.G2004",
+ "nt2": "BA.G2004",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "BA.G2005",
+ "nt2": "BB.G2005",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "BC.G2005",
+ "nt2": "BA.G2005",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "BA.U2006",
+ "nt2": "BB.U2006",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "BC.U2006",
+ "nt2": "BA.U2006",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ }
+ ],
+ "helices": [
+ {
+ "quadruplexes": [
+ {
+ "tetrads": [
+ {
+ "id": "A.U1006-AC.U1006-AA.U1006-AB.U1006",
+ "nt1": "A.U1006",
+ "nt2": "AC.U1006",
+ "nt3": "AA.U1006",
+ "nt4": "AB.U1006",
+ "onz": "O-",
+ "gbaClassification": "VIIIa",
+ "planarityDeviation": 1.061,
+ "ionsChannel": [
+ "NA"
+ ],
+ "ionsOutside": [
+ {
+ "nt": "A.U1006",
+ "ion": "SR"
+ },
+ {
+ "nt": "AA.U1006",
+ "ion": "SR"
+ },
+ {
+ "nt": "AB.U1006",
+ "ion": "SR"
+ },
+ {
+ "nt": "AC.U1006",
+ "ion": "SR"
+ }
+ ]
+ },
+ {
+ "id": "A.G1005-AC.G1005-AA.G1005-AB.G1005",
+ "nt1": "A.G1005",
+ "nt2": "AC.G1005",
+ "nt3": "AA.G1005",
+ "nt4": "AB.G1005",
+ "onz": "O+",
+ "gbaClassification": "VIIIa",
+ "planarityDeviation": 0.7999999999999972,
+ "ionsChannel": [],
+ "ionsOutside": []
+ },
+ {
+ "id": "A.G1004-AC.G1004-AA.G1004-AB.G1004",
+ "nt1": "A.G1004",
+ "nt2": "AC.G1004",
+ "nt3": "AA.G1004",
+ "nt4": "AB.G1004",
+ "onz": "O+",
+ "gbaClassification": "VIIIa",
+ "planarityDeviation": 0.4059999999999988,
+ "ionsChannel": [
+ "SR"
+ ],
+ "ionsOutside": []
+ },
+ {
+ "id": "A.G1003-AC.G1003-AA.G1003-AB.G1003",
+ "nt1": "A.G1003",
+ "nt2": "AC.G1003",
+ "nt3": "AA.G1003",
+ "nt4": "AB.G1003",
+ "onz": "O+",
+ "gbaClassification": "VIIIa",
+ "planarityDeviation": 0.5549999999999997,
+ "ionsChannel": [
+ "SR"
+ ],
+ "ionsOutside": []
+ },
+ {
+ "id": "A.G1002-AC.G1002-AA.G1002-AB.G1002",
+ "nt1": "A.G1002",
+ "nt2": "AC.G1002",
+ "nt3": "AA.G1002",
+ "nt4": "AB.G1002",
+ "onz": "O+",
+ "gbaClassification": "VIIIa",
+ "planarityDeviation": 0.541999999999998,
+ "ionsChannel": [],
+ "ionsOutside": [
+ {
+ "nt": "AB.G1002",
+ "ion": "CA"
+ },
+ {
+ "nt": "AC.G1002",
+ "ion": "CA"
+ },
+ {
+ "nt": "AA.G1002",
+ "ion": "CA"
+ },
+ {
+ "nt": "A.G1002",
+ "ion": "CA"
+ }
+ ]
+ }
+ ],
+ "onzm": "Op*",
+ "loopClassification": null,
+ "gbaClassification": [
+ "VIII"
+ ],
+ "tracts": [
+ [
+ "A.U1006",
+ "A.G1005",
+ "A.G1004",
+ "A.G1003",
+ "A.G1002"
+ ],
+ [
+ "AC.U1006",
+ "AC.G1005",
+ "AC.G1004",
+ "AC.G1003",
+ "AC.G1002"
+ ],
+ [
+ "AA.U1006",
+ "AA.G1005",
+ "AA.G1004",
+ "AA.G1003",
+ "AA.G1002"
+ ],
+ [
+ "AB.U1006",
+ "AB.G1005",
+ "AB.G1004",
+ "AB.G1003",
+ "AB.G1002"
+ ]
+ ],
+ "loops": []
+ },
+ {
+ "tetrads": [
+ {
+ "id": "B.G2002-BC.G2002-BA.G2002-BB.G2002",
+ "nt1": "B.G2002",
+ "nt2": "BC.G2002",
+ "nt3": "BA.G2002",
+ "nt4": "BB.G2002",
+ "onz": "O+",
+ "gbaClassification": "VIIIa",
+ "planarityDeviation": 0.6730000000000018,
+ "ionsChannel": [],
+ "ionsOutside": []
+ },
+ {
+ "id": "B.G2003-BC.G2003-BA.G2003-BB.G2003",
+ "nt1": "B.G2003",
+ "nt2": "BC.G2003",
+ "nt3": "BA.G2003",
+ "nt4": "BB.G2003",
+ "onz": "O+",
+ "gbaClassification": "VIIIa",
+ "planarityDeviation": 0.5769999999999982,
+ "ionsChannel": [
+ "SR"
+ ],
+ "ionsOutside": [
+ {
+ "nt": "B.G2003",
+ "ion": "CA"
+ },
+ {
+ "nt": "BA.G2003",
+ "ion": "CA"
+ },
+ {
+ "nt": "BB.G2003",
+ "ion": "CA"
+ },
+ {
+ "nt": "BC.G2003",
+ "ion": "CA"
+ }
+ ]
+ },
+ {
+ "id": "B.G2004-BC.G2004-BA.G2004-BB.G2004",
+ "nt1": "B.G2004",
+ "nt2": "BC.G2004",
+ "nt3": "BA.G2004",
+ "nt4": "BB.G2004",
+ "onz": "O+",
+ "gbaClassification": "VIIIa",
+ "planarityDeviation": 0.2289999999999992,
+ "ionsChannel": [
+ "SR"
+ ],
+ "ionsOutside": []
+ },
+ {
+ "id": "B.G2005-BC.G2005-BA.G2005-BB.G2005",
+ "nt1": "B.G2005",
+ "nt2": "BC.G2005",
+ "nt3": "BA.G2005",
+ "nt4": "BB.G2005",
+ "onz": "O+",
+ "gbaClassification": "VIIIa",
+ "planarityDeviation": 0.7810000000000006,
+ "ionsChannel": [
+ "NA"
+ ],
+ "ionsOutside": []
+ },
+ {
+ "id": "B.U2006-BC.U2006-BA.U2006-BB.U2006",
+ "nt1": "B.U2006",
+ "nt2": "BC.U2006",
+ "nt3": "BA.U2006",
+ "nt4": "BB.U2006",
+ "onz": "O-",
+ "gbaClassification": "VIIIa",
+ "planarityDeviation": 1.5840000000000005,
+ "ionsChannel": [
+ "NA",
+ "NA"
+ ],
+ "ionsOutside": []
+ }
+ ],
+ "onzm": "Op*",
+ "loopClassification": null,
+ "gbaClassification": [
+ "VIII"
+ ],
+ "tracts": [
+ [
+ "B.G2002",
+ "B.G2003",
+ "B.G2004",
+ "B.G2005",
+ "B.U2006"
+ ],
+ [
+ "BC.G2002",
+ "BC.G2003",
+ "BC.G2004",
+ "BC.G2005",
+ "BC.U2006"
+ ],
+ [
+ "BA.G2002",
+ "BA.G2003",
+ "BA.G2004",
+ "BA.G2005",
+ "BA.U2006"
+ ],
+ [
+ "BB.G2002",
+ "BB.G2003",
+ "BB.G2004",
+ "BB.G2005",
+ "BB.U2006"
+ ]
+ ],
+ "loops": []
+ }
+ ],
+ "tetradPairs": [
+ {
+ "tetrad1": "A.U1006-AC.U1006-AA.U1006-AB.U1006",
+ "tetrad2": "A.G1005-AC.G1005-AA.G1005-AB.G1005",
+ "direction": "parallel",
+ "rise": 3.366499999999995,
+ "twist": 39.962531742191736
+ },
+ {
+ "tetrad1": "A.G1005-AC.G1005-AA.G1005-AB.G1005",
+ "tetrad2": "A.G1004-AC.G1004-AA.G1004-AB.G1004",
+ "direction": "parallel",
+ "rise": 3.308000000000007,
+ "twist": 25.89614444631925
+ },
+ {
+ "tetrad1": "A.G1004-AC.G1004-AA.G1004-AB.G1004",
+ "tetrad2": "A.G1003-AC.G1003-AA.G1003-AB.G1003",
+ "direction": "parallel",
+ "rise": 3.339499999999994,
+ "twist": 35.81115298630443
+ },
+ {
+ "tetrad1": "A.G1003-AC.G1003-AA.G1003-AB.G1003",
+ "tetrad2": "A.G1002-AC.G1002-AA.G1002-AB.G1002",
+ "direction": "parallel",
+ "rise": 3.2865,
+ "twist": 27.11515971986803
+ },
+ {
+ "tetrad1": "A.G1002-AC.G1002-AA.G1002-AB.G1002",
+ "tetrad2": "B.G2002-BC.G2002-BA.G2002-BB.G2002",
+ "direction": "parallel",
+ "rise": 3.369500000000002,
+ "twist": 28.993180312675573
+ },
+ {
+ "tetrad1": "B.G2002-BC.G2002-BA.G2002-BB.G2002",
+ "tetrad2": "B.G2003-BC.G2003-BA.G2003-BB.G2003",
+ "direction": "parallel",
+ "rise": 3.371000000000002,
+ "twist": 27.410084968596852
+ },
+ {
+ "tetrad1": "B.G2003-BC.G2003-BA.G2003-BB.G2003",
+ "tetrad2": "B.G2004-BC.G2004-BA.G2004-BB.G2004",
+ "direction": "parallel",
+ "rise": 3.318000000000005,
+ "twist": 35.04072146975963
+ },
+ {
+ "tetrad1": "B.G2004-BC.G2004-BA.G2004-BB.G2004",
+ "tetrad2": "B.G2005-BC.G2005-BA.G2005-BB.G2005",
+ "direction": "parallel",
+ "rise": 3.2689999999999966,
+ "twist": 25.149997949938147
+ },
+ {
+ "tetrad1": "B.G2005-BC.G2005-BA.G2005-BB.G2005",
+ "tetrad2": "B.U2006-BC.U2006-BA.U2006-BB.U2006",
+ "direction": "parallel",
+ "rise": 7.140499999999998,
+ "twist": 43.40609492262336
+ }
+ ]
+ }
+ ],
+ "dotBracket": {
+ "sequence": "UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU",
+ "line1": ".([{<A-.([{<A-.)]}>a-.)]}>a-.([{<A-.)]}>a-.([{<A-.)]}>a",
+ "line2": ".([{<A-.)]}>a-.([{<A-.)]}>a-.([{<A-.([{<A-.)]}>a-.)]}>a"
+ }
+}
+```
+
+</details>
+
+# Funding
+
+This research was supported by the National Science Centre, Poland
+\[2016/23/B/ST6/03931, 2019/35/B/ST6/03074\] and Mloda Kadra project
+\[09/91/SBAD/0684\] from Poznan University of Technology, and carried
+out in the European Centre for Bioinformatics and Genomics (Poland). The
+authors also acknowledge partial support by the statutory funds of
+Poznan University of Technology, Polish Ministry of Science and Higher
+Education, and the Institute of Bioorganic Chemistry, PAS within
+intramural financing program.
+
+# Bibliography
+
+<div id="refs" class="references csl-bib-body">
+
+1. Topology-Based Classification of Tetrads and Quadruplex
+ Structures. M. Popenda, J. Miskiewicz, J. Sarzynska, T. Zok, M.
+ Szachniuk. *Bioinformatics*. 2020. 36(4):1129–1134.
+ doi:[10.1093/bioinformatics/btz738](https://doi.org/10.1093/bioinformatics/btz738)
+
+2. ElTetrado: A Tool for Identification and Classification of Tetrads
+ and Quadruplexes. T. Zok, M. Popenda, M. Szachniuk. *BMC
+ Bioinformatics*. 2020. 21(1):40.
+ doi:[10.1186/s12859-020-3385-1](https://doi.org/10.1186/s12859-020-3385-1)
+
+3. R-Chie : A Web Server and R Package for Visualizing RNA Secondary
+ Structures. D. Lai, J.R. Proctor, J.Y.A. Zhu, I.M. Meyer. *Nucleic
+ Acids Research*. 2012. 40(12):e95.
+ doi:[f99845](https://doi.org/f99845)
+
+4. Geometric Nomenclature and Classification of RNA Base Pairs. N.B.
+ Leontis, E. Westhof. *RNA*. 2001. 7(4):499–512.
+ doi:[10.1017/s1355838201002515](https://doi.org/10.1017/s1355838201002515)
+
+</div>
+
+
+%package -n python3-eltetrado
+Summary: Find and classify tetrads and quadruplexes in DNA/RNA 3D structure
+Provides: python-eltetrado
+BuildRequires: python3-devel
+BuildRequires: python3-setuptools
+BuildRequires: python3-pip
+%description -n python3-eltetrado
+![](logo.svg)
+
+# Project description
+
+This is an application to analyze base pairing patterns of DNA/RNA 3D
+structures to find and classify tetrads and quadruplexes. ElTetrado
+assigns tetrads to one of the ONZ classes (O, N, Z) alongside with the
+directionality of the tetrad (+/-) determined by the bonds between bases
+and their non-canonical interactions. The interactions follow
+Leontis/Westhof classification (Leontis *et al.* 2001). Watson-Crick (W)
+edge of first base in the tetrad structure exposed to the Hoogsteen (H)
+edge of the next nucleobase from the same tetrad sets the tetrad
+directionality, clockwise (+) or anticlockwise (-). For more details,
+please refer to Zok *et al.* (2020) and Popenda *et al.* (2020)
+
+# Installation
+
+Please run:
+
+ pip install eltetrado
+
+If you have both Python 2 and Python 3 installed, you need to explicitly
+call `pip3`:
+
+ pip3 install eltetrado
+
+# Dependencies
+
+The project is written in Python 3.6+ and requires
+[mmcif](https://pypi.org/project/mmcif/),
+[orjson](https://github.com/ijl/orjson), [NumPy](https://numpy.org/) and
+[requests](https://docs.python-requests.org/en/latest/).
+
+Visualization is created by `R` 3.6+ script which uses
+[R4RNA](https://www.e-rna.org/r-chie/) (Lai *et al.* 2012) library. The
+dependency will be automatically installed if not present.
+
+Base pairs and stacking interactions are identified by
+[RNApolis](https://github.com/tzok/rnapolis-py).
+
+# Usage
+
+ElTetrado is a command line application, which requires to be provided
+with `--input` and a path to a PDB or PDBx/mmCIF file.
+
+By default, ElTetrado outputs textual results on the standard output. A
+JSON version of the output can be obtained with `--output` switch
+followed by a path where the file is supposed to be created.
+
+ElTetrado prepares visualization of the whole structure and of each
+N4-helices, quadruplexes and tetrads. This can be supplemented with
+canonical base pairs visualization when `--complete-2d` is set. All
+color settings are located in the first several lines of the `quadraw.R`
+file, you can easily change them without knowledge of R language. If you
+want ElTetrado to not visualize anything, pass `--no-image` switch to
+it.
+
+ usage: eltetrado [-h] [-i INPUT] [-o OUTPUT] [-m MODEL]
+ [--stacking-mismatch STACKING_MISMATCH] [--strict]
+ [--no-reorder] [--complete-2d] [--no-image]
+ [--dssr-json DSSR_JSON] [-v]
+
+ options:
+ -h, --help show this help message and exit
+ -i INPUT, --input INPUT
+ path to input PDB or PDBx/mmCIF file
+ -o OUTPUT, --output OUTPUT
+ (optional) path for output JSON file
+ -m MODEL, --model MODEL
+ (optional) model number to process
+ --stacking-mismatch STACKING_MISMATCH
+ a perfect tetrad stacking covers 4 nucleotides; this
+ option can be used with value 1 or 2 to allow this
+ number of nucleotides to be non-stacked with otherwise
+ well aligned tetrad [default=2]
+ --strict nucleotides in tetrad are found when linked only by
+ cWH pairing
+ --no-reorder chains of bi- and tetramolecular quadruplexes should
+ be reordered to be able to have them classified; when
+ this is set, chains will be processed in original
+ order, which for bi-/tetramolecular means that they
+ will likely be misclassified; use with care!
+ --complete-2d when set, the visualization will also show canonical
+ base pairs to provide context for the quadruplex
+ --no-image when set, the visualization will not be created at all
+ --dssr-json DSSR_JSON
+ (optional) provide a JSON file generated by DSSR to
+ read the secondary structure information from (use
+ --nmr and --json switches)
+ -v, --version show program's version number and exit
+
+# Chains reorder
+
+ElTetrado keeps a global and unique 5’-3’ index for every nucleotide
+which is independent from residue numbers. For example, if a structure
+has chain M with 60 nucleotides and chain N with 15 nucleotides, then
+ElTetrado will keep index between 0 and 74 which uniquely identifies
+every nucleotide. Initially, ElTetrado assigns this indices according to
+the order of chains in the input file. Therefore, if M preceded N then
+nucleotides in M will be indexed from 0 to 59 and in N from 60 to 74.
+Otherwise, nucleotides in N will be indexed from 0 to 14 and in M from
+15 to 74.
+
+When `--no-reorder` is present, this initial assignment is used.
+Otherwise, ElTetrado exhaustively checks all permutations of chains’
+orders. Every permutation check induces recalculation of the global and
+unique 5’-3’ index and in effect it changes ONZ classification of
+tetrads.
+
+ElTetrado keeps a table of tetrad classification scores according to
+these rules:
+
+- Type preference: `O` \> `N` \> `Z`
+- Direction preference: `+` \> `-`
+
+The table keeps low values for preferred classes i.e. `O+` is 0, `O-` is
+1 and so on up to `Z-` with score 5. For every permutation of chain
+orders, ElTetrado computes sum of scores for tetrads classification
+induced by 5’-3’ indexing. We select permutation with the minimum value.
+
+# Examples
+
+## 2HY9: Human telomere DNA quadruplex structure in K+ solution hybrid-1 form
+
+![](2hy9.png)
+
+ $ curl ftp://ftp.wwpdb.org/pub/pdb/data/structures/divided/mmCIF/my/2hy9.cif.gz | gzip -d > 2hy9.cif
+ $ ./eltetrado --input 2hy9.cif --output 2hy9.json
+
+ Chain order: 1
+ n4-helix with 3 tetrads
+ Oh* V,VI 9a -(pll) quadruplex with 3 tetrads
+ 1.DG4 1.DG22 1.DG18 1.DG10 cWH cWH cWH cWH O- Vb planarity=0.17
+ direction=hybrid rise=3.21 twist=16.23
+ 1.DG5 1.DG23 1.DG17 1.DG11 cHW cHW cHW cHW O+ Va planarity=0.1
+ direction=hybrid rise=3.11 twist=27.45
+ 1.DG6 1.DG24 1.DG16 1.DG12 cHW cHW cHW cHW O+ VIa planarity=0.18
+
+ Tracts:
+ 1.DG4, 1.DG5, 1.DG6
+ 1.DG22, 1.DG23, 1.DG24
+ 1.DG18, 1.DG17, 1.DG16
+ 1.DG10, 1.DG11, 1.DG12
+
+ Loops:
+ propeller- 1.DT7, 1.DT8, 1.DA9
+ lateral- 1.DT13, 1.DT14, 1.DA15
+ lateral+ 1.DT19, 1.DT20, 1.DA21
+
+ AAAGGGTTAGGGTTAGGGTTAGGGAA
+ ...([{...(((...)))...)]}..
+ ...([{...)]}...(((...)))..
+
+<details>
+<summary>
+Click to see the output JSON
+</summary>
+
+``` json
+{
+ "metals": [],
+ "nucleotides": [
+ {
+ "index": 1,
+ "chain": "1",
+ "number": 1,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DA1",
+ "shortName": "A",
+ "chi": 22.308282830857802,
+ "glycosidicBond": "syn"
+ },
+ {
+ "index": 2,
+ "chain": "1",
+ "number": 2,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DA2",
+ "shortName": "A",
+ "chi": -123.05454402191421,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 3,
+ "chain": "1",
+ "number": 3,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DA3",
+ "shortName": "A",
+ "chi": -94.96579955603106,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 4,
+ "chain": "1",
+ "number": 4,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DG4",
+ "shortName": "G",
+ "chi": 79.28363721639316,
+ "glycosidicBond": "syn"
+ },
+ {
+ "index": 5,
+ "chain": "1",
+ "number": 5,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DG5",
+ "shortName": "G",
+ "chi": -126.01709201555563,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 6,
+ "chain": "1",
+ "number": 6,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DG6",
+ "shortName": "G",
+ "chi": -127.26656202302102,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 7,
+ "chain": "1",
+ "number": 7,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DT7",
+ "shortName": "T",
+ "chi": -63.10830751967371,
+ "glycosidicBond": "syn"
+ },
+ {
+ "index": 8,
+ "chain": "1",
+ "number": 8,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DT8",
+ "shortName": "T",
+ "chi": -138.79520345559828,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 9,
+ "chain": "1",
+ "number": 9,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DA9",
+ "shortName": "A",
+ "chi": -148.83990757408878,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 10,
+ "chain": "1",
+ "number": 10,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DG10",
+ "shortName": "G",
+ "chi": 58.7787525019158,
+ "glycosidicBond": "syn"
+ },
+ {
+ "index": 11,
+ "chain": "1",
+ "number": 11,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DG11",
+ "shortName": "G",
+ "chi": -123.85746807924986,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 12,
+ "chain": "1",
+ "number": 12,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DG12",
+ "shortName": "G",
+ "chi": -84.36679807284759,
+ "glycosidicBond": "syn"
+ },
+ {
+ "index": 13,
+ "chain": "1",
+ "number": 13,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DT13",
+ "shortName": "T",
+ "chi": -30.819029132834157,
+ "glycosidicBond": "syn"
+ },
+ {
+ "index": 14,
+ "chain": "1",
+ "number": 14,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DT14",
+ "shortName": "T",
+ "chi": -168.51776782812965,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 15,
+ "chain": "1",
+ "number": 15,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DA15",
+ "shortName": "A",
+ "chi": -105.72881577106517,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 16,
+ "chain": "1",
+ "number": 16,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DG16",
+ "shortName": "G",
+ "chi": 74.3227942181243,
+ "glycosidicBond": "syn"
+ },
+ {
+ "index": 17,
+ "chain": "1",
+ "number": 17,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DG17",
+ "shortName": "G",
+ "chi": 81.08424926936044,
+ "glycosidicBond": "syn"
+ },
+ {
+ "index": 18,
+ "chain": "1",
+ "number": 18,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DG18",
+ "shortName": "G",
+ "chi": -122.90397217111551,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 19,
+ "chain": "1",
+ "number": 19,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DT19",
+ "shortName": "T",
+ "chi": -102.98239337113938,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 20,
+ "chain": "1",
+ "number": 20,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DT20",
+ "shortName": "T",
+ "chi": -112.1514601849715,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 21,
+ "chain": "1",
+ "number": 21,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DA21",
+ "shortName": "A",
+ "chi": -89.07113063649612,
+ "glycosidicBond": "syn"
+ },
+ {
+ "index": 22,
+ "chain": "1",
+ "number": 22,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DG22",
+ "shortName": "G",
+ "chi": 83.44318693001902,
+ "glycosidicBond": "syn"
+ },
+ {
+ "index": 23,
+ "chain": "1",
+ "number": 23,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DG23",
+ "shortName": "G",
+ "chi": -115.41210237198398,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 24,
+ "chain": "1",
+ "number": 24,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DG24",
+ "shortName": "G",
+ "chi": -111.14845782593531,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 25,
+ "chain": "1",
+ "number": 25,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DA25",
+ "shortName": "A",
+ "chi": -58.323530637551954,
+ "glycosidicBond": "syn"
+ },
+ {
+ "index": 26,
+ "chain": "1",
+ "number": 26,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DA26",
+ "shortName": "A",
+ "chi": -90.84065243137135,
+ "glycosidicBond": "anti"
+ }
+ ],
+ "basePairs": [
+ {
+ "nt1": "1.DA3",
+ "nt2": "1.DA21",
+ "lw": "cHW",
+ "inTetrad": false,
+ "canonical": false
+ },
+ {
+ "nt1": "1.DG4",
+ "nt2": "1.DG10",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "1.DG4",
+ "nt2": "1.DG22",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "1.DG5",
+ "nt2": "1.DG11",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "1.DG5",
+ "nt2": "1.DG23",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "1.DG6",
+ "nt2": "1.DG12",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "1.DG6",
+ "nt2": "1.DG24",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "1.DG10",
+ "nt2": "1.DG18",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "1.DG11",
+ "nt2": "1.DG17",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "1.DG12",
+ "nt2": "1.DG16",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "1.DT14",
+ "nt2": "1.DA25",
+ "lw": "tWW",
+ "inTetrad": false,
+ "canonical": false
+ },
+ {
+ "nt1": "1.DG16",
+ "nt2": "1.DG24",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "1.DG17",
+ "nt2": "1.DG23",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "1.DG18",
+ "nt2": "1.DG22",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ }
+ ],
+ "helices": [
+ {
+ "quadruplexes": [
+ {
+ "tetrads": [
+ {
+ "id": "1.DG4-1.DG22-1.DG18-1.DG10",
+ "nt1": "1.DG4",
+ "nt2": "1.DG22",
+ "nt3": "1.DG18",
+ "nt4": "1.DG10",
+ "onz": "O-",
+ "gbaClassification": "Vb",
+ "planarityDeviation": 0.17372283960377805,
+ "ionsChannel": [],
+ "ionsOutside": []
+ },
+ {
+ "id": "1.DG5-1.DG23-1.DG17-1.DG11",
+ "nt1": "1.DG5",
+ "nt2": "1.DG23",
+ "nt3": "1.DG17",
+ "nt4": "1.DG11",
+ "onz": "O+",
+ "gbaClassification": "Va",
+ "planarityDeviation": 0.10474313820007483,
+ "ionsChannel": [],
+ "ionsOutside": []
+ },
+ {
+ "id": "1.DG6-1.DG24-1.DG16-1.DG12",
+ "nt1": "1.DG6",
+ "nt2": "1.DG24",
+ "nt3": "1.DG16",
+ "nt4": "1.DG12",
+ "onz": "O+",
+ "gbaClassification": "VIa",
+ "planarityDeviation": 0.18293509778060615,
+ "ionsChannel": [],
+ "ionsOutside": []
+ }
+ ],
+ "onzm": "Oh*",
+ "loopClassification": {
+ "classification": "9a",
+ "loopProgression": "-(pll)"
+ },
+ "gbaClassification": [
+ "V",
+ "VI"
+ ],
+ "tracts": [
+ [
+ "1.DG4",
+ "1.DG5",
+ "1.DG6"
+ ],
+ [
+ "1.DG22",
+ "1.DG23",
+ "1.DG24"
+ ],
+ [
+ "1.DG18",
+ "1.DG17",
+ "1.DG16"
+ ],
+ [
+ "1.DG10",
+ "1.DG11",
+ "1.DG12"
+ ]
+ ],
+ "loops": [
+ {
+ "type": "propeller-",
+ "nucleotides": [
+ "1.DT7",
+ "1.DT8",
+ "1.DA9"
+ ]
+ },
+ {
+ "type": "lateral-",
+ "nucleotides": [
+ "1.DT13",
+ "1.DT14",
+ "1.DA15"
+ ]
+ },
+ {
+ "type": "lateral+",
+ "nucleotides": [
+ "1.DT19",
+ "1.DT20",
+ "1.DA21"
+ ]
+ }
+ ]
+ }
+ ],
+ "tetradPairs": [
+ {
+ "tetrad1": "1.DG4-1.DG22-1.DG18-1.DG10",
+ "tetrad2": "1.DG5-1.DG23-1.DG17-1.DG11",
+ "direction": "hybrid",
+ "rise": 3.2109650905140654,
+ "twist": 16.228973729066034
+ },
+ {
+ "tetrad1": "1.DG5-1.DG23-1.DG17-1.DG11",
+ "tetrad2": "1.DG6-1.DG24-1.DG16-1.DG12",
+ "direction": "hybrid",
+ "rise": 3.1149939255558747,
+ "twist": 27.448958336697046
+ }
+ ]
+ }
+ ],
+ "dotBracket": {
+ "sequence": "AAAGGGTTAGGGTTAGGGTTAGGGAA",
+ "line1": "...([{...(((...)))...)]}..",
+ "line2": "...([{...)]}...(((...))).."
+ }
+}
+```
+
+</details>
+
+## 4RJ1: Structural variations and solvent structure of UGGGGU quadruplexes stabilized by Sr2+ ions
+
+![](4rj1.png)
+
+ $ curl https://www.ebi.ac.uk/pdbe/static/entry/download/4rj1-assembly-1.cif.gz | gzip -d > 4rj1-1.cif
+ $ ./eltetrado --input 4rj1-1.cif --output 4rj1-1.json
+
+ Chain order: A AB AA AC B BC BA BB
+ n4-helix with 10 tetrads
+ Op* VIII n/a quadruplex with 5 tetrads
+ A.U1006 AC.U1006 AA.U1006 AB.U1006 cWH cWH cWH cWH O- VIIIa planarity=1.06 ions_channel=NA ions_outside=A.U1006: [SR] AA.U1006: [SR] AB.U1006: [SR] AC.U1006: [SR]
+ direction=parallel rise=3.37 twist=39.96
+ A.G1005 AC.G1005 AA.G1005 AB.G1005 cHW cHW cHW cHW O+ VIIIa planarity=0.8
+ direction=parallel rise=3.31 twist=25.9
+ A.G1004 AC.G1004 AA.G1004 AB.G1004 cHW cHW cHW cHW O+ VIIIa planarity=0.41 ions_channel=SR
+ direction=parallel rise=3.34 twist=35.81
+ A.G1003 AC.G1003 AA.G1003 AB.G1003 cHW cHW cHW cHW O+ VIIIa planarity=0.55 ions_channel=SR
+ direction=parallel rise=3.29 twist=27.12
+ A.G1002 AC.G1002 AA.G1002 AB.G1002 cHW cHW cHW cHW O+ VIIIa planarity=0.54 ions_outside=AB.G1002: [CA] AC.G1002: [CA] AA.G1002: [CA] A.G1002: [CA]
+
+ Tracts:
+ A.U1006, A.G1005, A.G1004, A.G1003, A.G1002
+ AC.U1006, AC.G1005, AC.G1004, AC.G1003, AC.G1002
+ AA.U1006, AA.G1005, AA.G1004, AA.G1003, AA.G1002
+ AB.U1006, AB.G1005, AB.G1004, AB.G1003, AB.G1002
+
+ Op* VIII n/a quadruplex with 5 tetrads
+ B.G2002 BC.G2002 BA.G2002 BB.G2002 cWH cWH cWH cWH O+ VIIIa planarity=0.67
+ direction=parallel rise=3.37 twist=27.41
+ B.G2003 BC.G2003 BA.G2003 BB.G2003 cWH cWH cWH cWH O+ VIIIa planarity=0.58 ions_channel=SR ions_outside=B.G2003: [CA] BA.G2003: [CA] BB.G2003: [CA] BC.G2003: [CA]
+ direction=parallel rise=3.32 twist=35.04
+ B.G2004 BC.G2004 BA.G2004 BB.G2004 cWH cWH cWH cWH O+ VIIIa planarity=0.23 ions_channel=SR
+ direction=parallel rise=3.27 twist=25.15
+ B.G2005 BC.G2005 BA.G2005 BB.G2005 cWH cWH cWH cWH O+ VIIIa planarity=0.78 ions_channel=NA
+ direction=parallel rise=7.14 twist=43.41
+ B.U2006 BC.U2006 BA.U2006 BB.U2006 cHW cHW cHW cHW O- VIIIa planarity=1.58 ions_channel=NA,NA
+
+ Tracts:
+ B.G2002, B.G2003, B.G2004, B.G2005, B.U2006
+ BC.G2002, BC.G2003, BC.G2004, BC.G2005, BC.U2006
+ BA.G2002, BA.G2003, BA.G2004, BA.G2005, BA.U2006
+ BB.G2002, BB.G2003, BB.G2004, BB.G2005, BB.U2006
+
+ UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU
+ .([{<A-.([{<A-.)]}>a-.)]}>a-.([{<A-.)]}>a-.([{<A-.)]}>a
+ .([{<A-.)]}>a-.([{<A-.)]}>a-.([{<A-.([{<A-.)]}>a-.)]}>a
+
+<details>
+<summary>
+Click to see the output JSON
+</summary>
+
+``` json
+{
+ "metals": [
+ {
+ "symbol": "Sr",
+ "count": 8
+ },
+ {
+ "symbol": "Na",
+ "count": 4
+ },
+ {
+ "symbol": "Ca",
+ "count": 12
+ }
+ ],
+ "nucleotides": [
+ {
+ "index": 1,
+ "chain": "A",
+ "number": 1001,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "A.U1001",
+ "shortName": "U",
+ "chi": -141.92671313255752,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 2,
+ "chain": "A",
+ "number": 1002,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "A.G1002",
+ "shortName": "G",
+ "chi": -165.93034671112116,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 3,
+ "chain": "A",
+ "number": 1003,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "A.G1003",
+ "shortName": "G",
+ "chi": -121.5652426033226,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 4,
+ "chain": "A",
+ "number": 1004,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "A.G1004",
+ "shortName": "G",
+ "chi": -156.00957673923344,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 5,
+ "chain": "A",
+ "number": 1005,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "A.G1005",
+ "shortName": "G",
+ "chi": -148.10051684016415,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 6,
+ "chain": "A",
+ "number": 1006,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "A.U1006",
+ "shortName": "U",
+ "chi": -137.28005568139983,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 13,
+ "chain": "AA",
+ "number": 1001,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AA.U1001",
+ "shortName": "U",
+ "chi": -141.9267131325575,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 14,
+ "chain": "AA",
+ "number": 1002,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AA.G1002",
+ "shortName": "G",
+ "chi": -165.93034671112113,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 15,
+ "chain": "AA",
+ "number": 1003,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AA.G1003",
+ "shortName": "G",
+ "chi": -121.56524260332266,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 16,
+ "chain": "AA",
+ "number": 1004,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AA.G1004",
+ "shortName": "G",
+ "chi": -156.0095767392335,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 17,
+ "chain": "AA",
+ "number": 1005,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AA.G1005",
+ "shortName": "G",
+ "chi": -148.10051684016406,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 18,
+ "chain": "AA",
+ "number": 1006,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AA.U1006",
+ "shortName": "U",
+ "chi": -137.2800556813998,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 7,
+ "chain": "AB",
+ "number": 1001,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AB.U1001",
+ "shortName": "U",
+ "chi": -141.9267131325574,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 8,
+ "chain": "AB",
+ "number": 1002,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AB.G1002",
+ "shortName": "G",
+ "chi": -165.93034671112113,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 9,
+ "chain": "AB",
+ "number": 1003,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AB.G1003",
+ "shortName": "G",
+ "chi": -121.56524260332266,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 10,
+ "chain": "AB",
+ "number": 1004,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AB.G1004",
+ "shortName": "G",
+ "chi": -156.00957673923347,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 11,
+ "chain": "AB",
+ "number": 1005,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AB.G1005",
+ "shortName": "G",
+ "chi": -148.10051684016406,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 12,
+ "chain": "AB",
+ "number": 1006,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AB.U1006",
+ "shortName": "U",
+ "chi": -137.28005568139977,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 19,
+ "chain": "AC",
+ "number": 1001,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AC.U1001",
+ "shortName": "U",
+ "chi": -141.92671313255747,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 20,
+ "chain": "AC",
+ "number": 1002,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AC.G1002",
+ "shortName": "G",
+ "chi": -165.93034671112116,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 21,
+ "chain": "AC",
+ "number": 1003,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AC.G1003",
+ "shortName": "G",
+ "chi": -121.56524260332266,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 22,
+ "chain": "AC",
+ "number": 1004,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AC.G1004",
+ "shortName": "G",
+ "chi": -156.00957673923352,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 23,
+ "chain": "AC",
+ "number": 1005,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AC.G1005",
+ "shortName": "G",
+ "chi": -148.1005168401641,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 24,
+ "chain": "AC",
+ "number": 1006,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AC.U1006",
+ "shortName": "U",
+ "chi": -137.28005568139986,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 25,
+ "chain": "B",
+ "number": 2001,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "B.U2001",
+ "shortName": "U",
+ "chi": -146.4615316869476,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 26,
+ "chain": "B",
+ "number": 2002,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "B.G2002",
+ "shortName": "G",
+ "chi": -170.79660912745996,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 27,
+ "chain": "B",
+ "number": 2003,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "B.G2003",
+ "shortName": "G",
+ "chi": -117.68718110874113,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 28,
+ "chain": "B",
+ "number": 2004,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "B.G2004",
+ "shortName": "G",
+ "chi": -153.88587375071324,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 29,
+ "chain": "B",
+ "number": 2005,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "B.G2005",
+ "shortName": "G",
+ "chi": -148.8519912845669,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 30,
+ "chain": "B",
+ "number": 2006,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "B.U2006",
+ "shortName": "U",
+ "chi": -159.43730655241544,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 37,
+ "chain": "BA",
+ "number": 2001,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BA.U2001",
+ "shortName": "U",
+ "chi": -146.46153168694764,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 38,
+ "chain": "BA",
+ "number": 2002,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BA.G2002",
+ "shortName": "G",
+ "chi": -170.79660912745993,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 39,
+ "chain": "BA",
+ "number": 2003,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BA.G2003",
+ "shortName": "G",
+ "chi": -117.68718110874113,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 40,
+ "chain": "BA",
+ "number": 2004,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BA.G2004",
+ "shortName": "G",
+ "chi": -153.88587375071322,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 41,
+ "chain": "BA",
+ "number": 2005,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BA.G2005",
+ "shortName": "G",
+ "chi": -148.851991284567,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 42,
+ "chain": "BA",
+ "number": 2006,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BA.U2006",
+ "shortName": "U",
+ "chi": -159.43730655241544,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 43,
+ "chain": "BB",
+ "number": 2001,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BB.U2001",
+ "shortName": "U",
+ "chi": -146.4615316869476,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 44,
+ "chain": "BB",
+ "number": 2002,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BB.G2002",
+ "shortName": "G",
+ "chi": -170.79660912745993,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 45,
+ "chain": "BB",
+ "number": 2003,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BB.G2003",
+ "shortName": "G",
+ "chi": -117.68718110874106,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 46,
+ "chain": "BB",
+ "number": 2004,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BB.G2004",
+ "shortName": "G",
+ "chi": -153.8858737507132,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 47,
+ "chain": "BB",
+ "number": 2005,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BB.G2005",
+ "shortName": "G",
+ "chi": -148.85199128456696,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 48,
+ "chain": "BB",
+ "number": 2006,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BB.U2006",
+ "shortName": "U",
+ "chi": -159.43730655241544,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 31,
+ "chain": "BC",
+ "number": 2001,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BC.U2001",
+ "shortName": "U",
+ "chi": -146.4615316869476,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 32,
+ "chain": "BC",
+ "number": 2002,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BC.G2002",
+ "shortName": "G",
+ "chi": -170.79660912745993,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 33,
+ "chain": "BC",
+ "number": 2003,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BC.G2003",
+ "shortName": "G",
+ "chi": -117.68718110874121,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 34,
+ "chain": "BC",
+ "number": 2004,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BC.G2004",
+ "shortName": "G",
+ "chi": -153.88587375071322,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 35,
+ "chain": "BC",
+ "number": 2005,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BC.G2005",
+ "shortName": "G",
+ "chi": -148.85199128456694,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 36,
+ "chain": "BC",
+ "number": 2006,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BC.U2006",
+ "shortName": "U",
+ "chi": -159.43730655241544,
+ "glycosidicBond": "anti"
+ }
+ ],
+ "basePairs": [
+ {
+ "nt1": "A.G1002",
+ "nt2": "AB.G1002",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "A.G1002",
+ "nt2": "AC.G1002",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "A.G1003",
+ "nt2": "AB.G1003",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "A.G1003",
+ "nt2": "AC.G1003",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "A.G1004",
+ "nt2": "AB.G1004",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "A.G1004",
+ "nt2": "AC.G1004",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "A.G1005",
+ "nt2": "AB.G1005",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "A.G1005",
+ "nt2": "AC.G1005",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "A.U1006",
+ "nt2": "AB.U1006",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "A.U1006",
+ "nt2": "AC.U1006",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "AB.G1002",
+ "nt2": "AA.G1002",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "AA.G1002",
+ "nt2": "AC.G1002",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "AB.G1003",
+ "nt2": "AA.G1003",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "AA.G1003",
+ "nt2": "AC.G1003",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "AB.G1004",
+ "nt2": "AA.G1004",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "AA.G1004",
+ "nt2": "AC.G1004",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "AB.G1005",
+ "nt2": "AA.G1005",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "AA.G1005",
+ "nt2": "AC.G1005",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "AB.U1006",
+ "nt2": "AA.U1006",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "AA.U1006",
+ "nt2": "AC.U1006",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "B.G2002",
+ "nt2": "BB.G2002",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "B.G2002",
+ "nt2": "BC.G2002",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "B.G2003",
+ "nt2": "BB.G2003",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "B.G2003",
+ "nt2": "BC.G2003",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "B.G2004",
+ "nt2": "BB.G2004",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "B.G2004",
+ "nt2": "BC.G2004",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "B.G2005",
+ "nt2": "BB.G2005",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "B.G2005",
+ "nt2": "BC.G2005",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "B.U2006",
+ "nt2": "BB.U2006",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "B.U2006",
+ "nt2": "BC.U2006",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "BA.G2002",
+ "nt2": "BB.G2002",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "BC.G2002",
+ "nt2": "BA.G2002",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "BA.G2003",
+ "nt2": "BB.G2003",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "BC.G2003",
+ "nt2": "BA.G2003",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "BA.G2004",
+ "nt2": "BB.G2004",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "BC.G2004",
+ "nt2": "BA.G2004",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "BA.G2005",
+ "nt2": "BB.G2005",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "BC.G2005",
+ "nt2": "BA.G2005",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "BA.U2006",
+ "nt2": "BB.U2006",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "BC.U2006",
+ "nt2": "BA.U2006",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ }
+ ],
+ "helices": [
+ {
+ "quadruplexes": [
+ {
+ "tetrads": [
+ {
+ "id": "A.U1006-AC.U1006-AA.U1006-AB.U1006",
+ "nt1": "A.U1006",
+ "nt2": "AC.U1006",
+ "nt3": "AA.U1006",
+ "nt4": "AB.U1006",
+ "onz": "O-",
+ "gbaClassification": "VIIIa",
+ "planarityDeviation": 1.061,
+ "ionsChannel": [
+ "NA"
+ ],
+ "ionsOutside": [
+ {
+ "nt": "A.U1006",
+ "ion": "SR"
+ },
+ {
+ "nt": "AA.U1006",
+ "ion": "SR"
+ },
+ {
+ "nt": "AB.U1006",
+ "ion": "SR"
+ },
+ {
+ "nt": "AC.U1006",
+ "ion": "SR"
+ }
+ ]
+ },
+ {
+ "id": "A.G1005-AC.G1005-AA.G1005-AB.G1005",
+ "nt1": "A.G1005",
+ "nt2": "AC.G1005",
+ "nt3": "AA.G1005",
+ "nt4": "AB.G1005",
+ "onz": "O+",
+ "gbaClassification": "VIIIa",
+ "planarityDeviation": 0.7999999999999972,
+ "ionsChannel": [],
+ "ionsOutside": []
+ },
+ {
+ "id": "A.G1004-AC.G1004-AA.G1004-AB.G1004",
+ "nt1": "A.G1004",
+ "nt2": "AC.G1004",
+ "nt3": "AA.G1004",
+ "nt4": "AB.G1004",
+ "onz": "O+",
+ "gbaClassification": "VIIIa",
+ "planarityDeviation": 0.4059999999999988,
+ "ionsChannel": [
+ "SR"
+ ],
+ "ionsOutside": []
+ },
+ {
+ "id": "A.G1003-AC.G1003-AA.G1003-AB.G1003",
+ "nt1": "A.G1003",
+ "nt2": "AC.G1003",
+ "nt3": "AA.G1003",
+ "nt4": "AB.G1003",
+ "onz": "O+",
+ "gbaClassification": "VIIIa",
+ "planarityDeviation": 0.5549999999999997,
+ "ionsChannel": [
+ "SR"
+ ],
+ "ionsOutside": []
+ },
+ {
+ "id": "A.G1002-AC.G1002-AA.G1002-AB.G1002",
+ "nt1": "A.G1002",
+ "nt2": "AC.G1002",
+ "nt3": "AA.G1002",
+ "nt4": "AB.G1002",
+ "onz": "O+",
+ "gbaClassification": "VIIIa",
+ "planarityDeviation": 0.541999999999998,
+ "ionsChannel": [],
+ "ionsOutside": [
+ {
+ "nt": "AB.G1002",
+ "ion": "CA"
+ },
+ {
+ "nt": "AC.G1002",
+ "ion": "CA"
+ },
+ {
+ "nt": "AA.G1002",
+ "ion": "CA"
+ },
+ {
+ "nt": "A.G1002",
+ "ion": "CA"
+ }
+ ]
+ }
+ ],
+ "onzm": "Op*",
+ "loopClassification": null,
+ "gbaClassification": [
+ "VIII"
+ ],
+ "tracts": [
+ [
+ "A.U1006",
+ "A.G1005",
+ "A.G1004",
+ "A.G1003",
+ "A.G1002"
+ ],
+ [
+ "AC.U1006",
+ "AC.G1005",
+ "AC.G1004",
+ "AC.G1003",
+ "AC.G1002"
+ ],
+ [
+ "AA.U1006",
+ "AA.G1005",
+ "AA.G1004",
+ "AA.G1003",
+ "AA.G1002"
+ ],
+ [
+ "AB.U1006",
+ "AB.G1005",
+ "AB.G1004",
+ "AB.G1003",
+ "AB.G1002"
+ ]
+ ],
+ "loops": []
+ },
+ {
+ "tetrads": [
+ {
+ "id": "B.G2002-BC.G2002-BA.G2002-BB.G2002",
+ "nt1": "B.G2002",
+ "nt2": "BC.G2002",
+ "nt3": "BA.G2002",
+ "nt4": "BB.G2002",
+ "onz": "O+",
+ "gbaClassification": "VIIIa",
+ "planarityDeviation": 0.6730000000000018,
+ "ionsChannel": [],
+ "ionsOutside": []
+ },
+ {
+ "id": "B.G2003-BC.G2003-BA.G2003-BB.G2003",
+ "nt1": "B.G2003",
+ "nt2": "BC.G2003",
+ "nt3": "BA.G2003",
+ "nt4": "BB.G2003",
+ "onz": "O+",
+ "gbaClassification": "VIIIa",
+ "planarityDeviation": 0.5769999999999982,
+ "ionsChannel": [
+ "SR"
+ ],
+ "ionsOutside": [
+ {
+ "nt": "B.G2003",
+ "ion": "CA"
+ },
+ {
+ "nt": "BA.G2003",
+ "ion": "CA"
+ },
+ {
+ "nt": "BB.G2003",
+ "ion": "CA"
+ },
+ {
+ "nt": "BC.G2003",
+ "ion": "CA"
+ }
+ ]
+ },
+ {
+ "id": "B.G2004-BC.G2004-BA.G2004-BB.G2004",
+ "nt1": "B.G2004",
+ "nt2": "BC.G2004",
+ "nt3": "BA.G2004",
+ "nt4": "BB.G2004",
+ "onz": "O+",
+ "gbaClassification": "VIIIa",
+ "planarityDeviation": 0.2289999999999992,
+ "ionsChannel": [
+ "SR"
+ ],
+ "ionsOutside": []
+ },
+ {
+ "id": "B.G2005-BC.G2005-BA.G2005-BB.G2005",
+ "nt1": "B.G2005",
+ "nt2": "BC.G2005",
+ "nt3": "BA.G2005",
+ "nt4": "BB.G2005",
+ "onz": "O+",
+ "gbaClassification": "VIIIa",
+ "planarityDeviation": 0.7810000000000006,
+ "ionsChannel": [
+ "NA"
+ ],
+ "ionsOutside": []
+ },
+ {
+ "id": "B.U2006-BC.U2006-BA.U2006-BB.U2006",
+ "nt1": "B.U2006",
+ "nt2": "BC.U2006",
+ "nt3": "BA.U2006",
+ "nt4": "BB.U2006",
+ "onz": "O-",
+ "gbaClassification": "VIIIa",
+ "planarityDeviation": 1.5840000000000005,
+ "ionsChannel": [
+ "NA",
+ "NA"
+ ],
+ "ionsOutside": []
+ }
+ ],
+ "onzm": "Op*",
+ "loopClassification": null,
+ "gbaClassification": [
+ "VIII"
+ ],
+ "tracts": [
+ [
+ "B.G2002",
+ "B.G2003",
+ "B.G2004",
+ "B.G2005",
+ "B.U2006"
+ ],
+ [
+ "BC.G2002",
+ "BC.G2003",
+ "BC.G2004",
+ "BC.G2005",
+ "BC.U2006"
+ ],
+ [
+ "BA.G2002",
+ "BA.G2003",
+ "BA.G2004",
+ "BA.G2005",
+ "BA.U2006"
+ ],
+ [
+ "BB.G2002",
+ "BB.G2003",
+ "BB.G2004",
+ "BB.G2005",
+ "BB.U2006"
+ ]
+ ],
+ "loops": []
+ }
+ ],
+ "tetradPairs": [
+ {
+ "tetrad1": "A.U1006-AC.U1006-AA.U1006-AB.U1006",
+ "tetrad2": "A.G1005-AC.G1005-AA.G1005-AB.G1005",
+ "direction": "parallel",
+ "rise": 3.366499999999995,
+ "twist": 39.962531742191736
+ },
+ {
+ "tetrad1": "A.G1005-AC.G1005-AA.G1005-AB.G1005",
+ "tetrad2": "A.G1004-AC.G1004-AA.G1004-AB.G1004",
+ "direction": "parallel",
+ "rise": 3.308000000000007,
+ "twist": 25.89614444631925
+ },
+ {
+ "tetrad1": "A.G1004-AC.G1004-AA.G1004-AB.G1004",
+ "tetrad2": "A.G1003-AC.G1003-AA.G1003-AB.G1003",
+ "direction": "parallel",
+ "rise": 3.339499999999994,
+ "twist": 35.81115298630443
+ },
+ {
+ "tetrad1": "A.G1003-AC.G1003-AA.G1003-AB.G1003",
+ "tetrad2": "A.G1002-AC.G1002-AA.G1002-AB.G1002",
+ "direction": "parallel",
+ "rise": 3.2865,
+ "twist": 27.11515971986803
+ },
+ {
+ "tetrad1": "A.G1002-AC.G1002-AA.G1002-AB.G1002",
+ "tetrad2": "B.G2002-BC.G2002-BA.G2002-BB.G2002",
+ "direction": "parallel",
+ "rise": 3.369500000000002,
+ "twist": 28.993180312675573
+ },
+ {
+ "tetrad1": "B.G2002-BC.G2002-BA.G2002-BB.G2002",
+ "tetrad2": "B.G2003-BC.G2003-BA.G2003-BB.G2003",
+ "direction": "parallel",
+ "rise": 3.371000000000002,
+ "twist": 27.410084968596852
+ },
+ {
+ "tetrad1": "B.G2003-BC.G2003-BA.G2003-BB.G2003",
+ "tetrad2": "B.G2004-BC.G2004-BA.G2004-BB.G2004",
+ "direction": "parallel",
+ "rise": 3.318000000000005,
+ "twist": 35.04072146975963
+ },
+ {
+ "tetrad1": "B.G2004-BC.G2004-BA.G2004-BB.G2004",
+ "tetrad2": "B.G2005-BC.G2005-BA.G2005-BB.G2005",
+ "direction": "parallel",
+ "rise": 3.2689999999999966,
+ "twist": 25.149997949938147
+ },
+ {
+ "tetrad1": "B.G2005-BC.G2005-BA.G2005-BB.G2005",
+ "tetrad2": "B.U2006-BC.U2006-BA.U2006-BB.U2006",
+ "direction": "parallel",
+ "rise": 7.140499999999998,
+ "twist": 43.40609492262336
+ }
+ ]
+ }
+ ],
+ "dotBracket": {
+ "sequence": "UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU",
+ "line1": ".([{<A-.([{<A-.)]}>a-.)]}>a-.([{<A-.)]}>a-.([{<A-.)]}>a",
+ "line2": ".([{<A-.)]}>a-.([{<A-.)]}>a-.([{<A-.([{<A-.)]}>a-.)]}>a"
+ }
+}
+```
+
+</details>
+
+# Funding
+
+This research was supported by the National Science Centre, Poland
+\[2016/23/B/ST6/03931, 2019/35/B/ST6/03074\] and Mloda Kadra project
+\[09/91/SBAD/0684\] from Poznan University of Technology, and carried
+out in the European Centre for Bioinformatics and Genomics (Poland). The
+authors also acknowledge partial support by the statutory funds of
+Poznan University of Technology, Polish Ministry of Science and Higher
+Education, and the Institute of Bioorganic Chemistry, PAS within
+intramural financing program.
+
+# Bibliography
+
+<div id="refs" class="references csl-bib-body">
+
+1. Topology-Based Classification of Tetrads and Quadruplex
+ Structures. M. Popenda, J. Miskiewicz, J. Sarzynska, T. Zok, M.
+ Szachniuk. *Bioinformatics*. 2020. 36(4):1129–1134.
+ doi:[10.1093/bioinformatics/btz738](https://doi.org/10.1093/bioinformatics/btz738)
+
+2. ElTetrado: A Tool for Identification and Classification of Tetrads
+ and Quadruplexes. T. Zok, M. Popenda, M. Szachniuk. *BMC
+ Bioinformatics*. 2020. 21(1):40.
+ doi:[10.1186/s12859-020-3385-1](https://doi.org/10.1186/s12859-020-3385-1)
+
+3. R-Chie : A Web Server and R Package for Visualizing RNA Secondary
+ Structures. D. Lai, J.R. Proctor, J.Y.A. Zhu, I.M. Meyer. *Nucleic
+ Acids Research*. 2012. 40(12):e95.
+ doi:[f99845](https://doi.org/f99845)
+
+4. Geometric Nomenclature and Classification of RNA Base Pairs. N.B.
+ Leontis, E. Westhof. *RNA*. 2001. 7(4):499–512.
+ doi:[10.1017/s1355838201002515](https://doi.org/10.1017/s1355838201002515)
+
+</div>
+
+
+%package help
+Summary: Development documents and examples for eltetrado
+Provides: python3-eltetrado-doc
+%description help
+![](logo.svg)
+
+# Project description
+
+This is an application to analyze base pairing patterns of DNA/RNA 3D
+structures to find and classify tetrads and quadruplexes. ElTetrado
+assigns tetrads to one of the ONZ classes (O, N, Z) alongside with the
+directionality of the tetrad (+/-) determined by the bonds between bases
+and their non-canonical interactions. The interactions follow
+Leontis/Westhof classification (Leontis *et al.* 2001). Watson-Crick (W)
+edge of first base in the tetrad structure exposed to the Hoogsteen (H)
+edge of the next nucleobase from the same tetrad sets the tetrad
+directionality, clockwise (+) or anticlockwise (-). For more details,
+please refer to Zok *et al.* (2020) and Popenda *et al.* (2020)
+
+# Installation
+
+Please run:
+
+ pip install eltetrado
+
+If you have both Python 2 and Python 3 installed, you need to explicitly
+call `pip3`:
+
+ pip3 install eltetrado
+
+# Dependencies
+
+The project is written in Python 3.6+ and requires
+[mmcif](https://pypi.org/project/mmcif/),
+[orjson](https://github.com/ijl/orjson), [NumPy](https://numpy.org/) and
+[requests](https://docs.python-requests.org/en/latest/).
+
+Visualization is created by `R` 3.6+ script which uses
+[R4RNA](https://www.e-rna.org/r-chie/) (Lai *et al.* 2012) library. The
+dependency will be automatically installed if not present.
+
+Base pairs and stacking interactions are identified by
+[RNApolis](https://github.com/tzok/rnapolis-py).
+
+# Usage
+
+ElTetrado is a command line application, which requires to be provided
+with `--input` and a path to a PDB or PDBx/mmCIF file.
+
+By default, ElTetrado outputs textual results on the standard output. A
+JSON version of the output can be obtained with `--output` switch
+followed by a path where the file is supposed to be created.
+
+ElTetrado prepares visualization of the whole structure and of each
+N4-helices, quadruplexes and tetrads. This can be supplemented with
+canonical base pairs visualization when `--complete-2d` is set. All
+color settings are located in the first several lines of the `quadraw.R`
+file, you can easily change them without knowledge of R language. If you
+want ElTetrado to not visualize anything, pass `--no-image` switch to
+it.
+
+ usage: eltetrado [-h] [-i INPUT] [-o OUTPUT] [-m MODEL]
+ [--stacking-mismatch STACKING_MISMATCH] [--strict]
+ [--no-reorder] [--complete-2d] [--no-image]
+ [--dssr-json DSSR_JSON] [-v]
+
+ options:
+ -h, --help show this help message and exit
+ -i INPUT, --input INPUT
+ path to input PDB or PDBx/mmCIF file
+ -o OUTPUT, --output OUTPUT
+ (optional) path for output JSON file
+ -m MODEL, --model MODEL
+ (optional) model number to process
+ --stacking-mismatch STACKING_MISMATCH
+ a perfect tetrad stacking covers 4 nucleotides; this
+ option can be used with value 1 or 2 to allow this
+ number of nucleotides to be non-stacked with otherwise
+ well aligned tetrad [default=2]
+ --strict nucleotides in tetrad are found when linked only by
+ cWH pairing
+ --no-reorder chains of bi- and tetramolecular quadruplexes should
+ be reordered to be able to have them classified; when
+ this is set, chains will be processed in original
+ order, which for bi-/tetramolecular means that they
+ will likely be misclassified; use with care!
+ --complete-2d when set, the visualization will also show canonical
+ base pairs to provide context for the quadruplex
+ --no-image when set, the visualization will not be created at all
+ --dssr-json DSSR_JSON
+ (optional) provide a JSON file generated by DSSR to
+ read the secondary structure information from (use
+ --nmr and --json switches)
+ -v, --version show program's version number and exit
+
+# Chains reorder
+
+ElTetrado keeps a global and unique 5’-3’ index for every nucleotide
+which is independent from residue numbers. For example, if a structure
+has chain M with 60 nucleotides and chain N with 15 nucleotides, then
+ElTetrado will keep index between 0 and 74 which uniquely identifies
+every nucleotide. Initially, ElTetrado assigns this indices according to
+the order of chains in the input file. Therefore, if M preceded N then
+nucleotides in M will be indexed from 0 to 59 and in N from 60 to 74.
+Otherwise, nucleotides in N will be indexed from 0 to 14 and in M from
+15 to 74.
+
+When `--no-reorder` is present, this initial assignment is used.
+Otherwise, ElTetrado exhaustively checks all permutations of chains’
+orders. Every permutation check induces recalculation of the global and
+unique 5’-3’ index and in effect it changes ONZ classification of
+tetrads.
+
+ElTetrado keeps a table of tetrad classification scores according to
+these rules:
+
+- Type preference: `O` \> `N` \> `Z`
+- Direction preference: `+` \> `-`
+
+The table keeps low values for preferred classes i.e. `O+` is 0, `O-` is
+1 and so on up to `Z-` with score 5. For every permutation of chain
+orders, ElTetrado computes sum of scores for tetrads classification
+induced by 5’-3’ indexing. We select permutation with the minimum value.
+
+# Examples
+
+## 2HY9: Human telomere DNA quadruplex structure in K+ solution hybrid-1 form
+
+![](2hy9.png)
+
+ $ curl ftp://ftp.wwpdb.org/pub/pdb/data/structures/divided/mmCIF/my/2hy9.cif.gz | gzip -d > 2hy9.cif
+ $ ./eltetrado --input 2hy9.cif --output 2hy9.json
+
+ Chain order: 1
+ n4-helix with 3 tetrads
+ Oh* V,VI 9a -(pll) quadruplex with 3 tetrads
+ 1.DG4 1.DG22 1.DG18 1.DG10 cWH cWH cWH cWH O- Vb planarity=0.17
+ direction=hybrid rise=3.21 twist=16.23
+ 1.DG5 1.DG23 1.DG17 1.DG11 cHW cHW cHW cHW O+ Va planarity=0.1
+ direction=hybrid rise=3.11 twist=27.45
+ 1.DG6 1.DG24 1.DG16 1.DG12 cHW cHW cHW cHW O+ VIa planarity=0.18
+
+ Tracts:
+ 1.DG4, 1.DG5, 1.DG6
+ 1.DG22, 1.DG23, 1.DG24
+ 1.DG18, 1.DG17, 1.DG16
+ 1.DG10, 1.DG11, 1.DG12
+
+ Loops:
+ propeller- 1.DT7, 1.DT8, 1.DA9
+ lateral- 1.DT13, 1.DT14, 1.DA15
+ lateral+ 1.DT19, 1.DT20, 1.DA21
+
+ AAAGGGTTAGGGTTAGGGTTAGGGAA
+ ...([{...(((...)))...)]}..
+ ...([{...)]}...(((...)))..
+
+<details>
+<summary>
+Click to see the output JSON
+</summary>
+
+``` json
+{
+ "metals": [],
+ "nucleotides": [
+ {
+ "index": 1,
+ "chain": "1",
+ "number": 1,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DA1",
+ "shortName": "A",
+ "chi": 22.308282830857802,
+ "glycosidicBond": "syn"
+ },
+ {
+ "index": 2,
+ "chain": "1",
+ "number": 2,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DA2",
+ "shortName": "A",
+ "chi": -123.05454402191421,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 3,
+ "chain": "1",
+ "number": 3,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DA3",
+ "shortName": "A",
+ "chi": -94.96579955603106,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 4,
+ "chain": "1",
+ "number": 4,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DG4",
+ "shortName": "G",
+ "chi": 79.28363721639316,
+ "glycosidicBond": "syn"
+ },
+ {
+ "index": 5,
+ "chain": "1",
+ "number": 5,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DG5",
+ "shortName": "G",
+ "chi": -126.01709201555563,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 6,
+ "chain": "1",
+ "number": 6,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DG6",
+ "shortName": "G",
+ "chi": -127.26656202302102,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 7,
+ "chain": "1",
+ "number": 7,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DT7",
+ "shortName": "T",
+ "chi": -63.10830751967371,
+ "glycosidicBond": "syn"
+ },
+ {
+ "index": 8,
+ "chain": "1",
+ "number": 8,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DT8",
+ "shortName": "T",
+ "chi": -138.79520345559828,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 9,
+ "chain": "1",
+ "number": 9,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DA9",
+ "shortName": "A",
+ "chi": -148.83990757408878,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 10,
+ "chain": "1",
+ "number": 10,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DG10",
+ "shortName": "G",
+ "chi": 58.7787525019158,
+ "glycosidicBond": "syn"
+ },
+ {
+ "index": 11,
+ "chain": "1",
+ "number": 11,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DG11",
+ "shortName": "G",
+ "chi": -123.85746807924986,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 12,
+ "chain": "1",
+ "number": 12,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DG12",
+ "shortName": "G",
+ "chi": -84.36679807284759,
+ "glycosidicBond": "syn"
+ },
+ {
+ "index": 13,
+ "chain": "1",
+ "number": 13,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DT13",
+ "shortName": "T",
+ "chi": -30.819029132834157,
+ "glycosidicBond": "syn"
+ },
+ {
+ "index": 14,
+ "chain": "1",
+ "number": 14,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DT14",
+ "shortName": "T",
+ "chi": -168.51776782812965,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 15,
+ "chain": "1",
+ "number": 15,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DA15",
+ "shortName": "A",
+ "chi": -105.72881577106517,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 16,
+ "chain": "1",
+ "number": 16,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DG16",
+ "shortName": "G",
+ "chi": 74.3227942181243,
+ "glycosidicBond": "syn"
+ },
+ {
+ "index": 17,
+ "chain": "1",
+ "number": 17,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DG17",
+ "shortName": "G",
+ "chi": 81.08424926936044,
+ "glycosidicBond": "syn"
+ },
+ {
+ "index": 18,
+ "chain": "1",
+ "number": 18,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DG18",
+ "shortName": "G",
+ "chi": -122.90397217111551,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 19,
+ "chain": "1",
+ "number": 19,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DT19",
+ "shortName": "T",
+ "chi": -102.98239337113938,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 20,
+ "chain": "1",
+ "number": 20,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DT20",
+ "shortName": "T",
+ "chi": -112.1514601849715,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 21,
+ "chain": "1",
+ "number": 21,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DA21",
+ "shortName": "A",
+ "chi": -89.07113063649612,
+ "glycosidicBond": "syn"
+ },
+ {
+ "index": 22,
+ "chain": "1",
+ "number": 22,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DG22",
+ "shortName": "G",
+ "chi": 83.44318693001902,
+ "glycosidicBond": "syn"
+ },
+ {
+ "index": 23,
+ "chain": "1",
+ "number": 23,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DG23",
+ "shortName": "G",
+ "chi": -115.41210237198398,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 24,
+ "chain": "1",
+ "number": 24,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DG24",
+ "shortName": "G",
+ "chi": -111.14845782593531,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 25,
+ "chain": "1",
+ "number": 25,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DA25",
+ "shortName": "A",
+ "chi": -58.323530637551954,
+ "glycosidicBond": "syn"
+ },
+ {
+ "index": 26,
+ "chain": "1",
+ "number": 26,
+ "icode": null,
+ "molecule": "DNA",
+ "fullName": "1.DA26",
+ "shortName": "A",
+ "chi": -90.84065243137135,
+ "glycosidicBond": "anti"
+ }
+ ],
+ "basePairs": [
+ {
+ "nt1": "1.DA3",
+ "nt2": "1.DA21",
+ "lw": "cHW",
+ "inTetrad": false,
+ "canonical": false
+ },
+ {
+ "nt1": "1.DG4",
+ "nt2": "1.DG10",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "1.DG4",
+ "nt2": "1.DG22",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "1.DG5",
+ "nt2": "1.DG11",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "1.DG5",
+ "nt2": "1.DG23",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "1.DG6",
+ "nt2": "1.DG12",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "1.DG6",
+ "nt2": "1.DG24",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "1.DG10",
+ "nt2": "1.DG18",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "1.DG11",
+ "nt2": "1.DG17",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "1.DG12",
+ "nt2": "1.DG16",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "1.DT14",
+ "nt2": "1.DA25",
+ "lw": "tWW",
+ "inTetrad": false,
+ "canonical": false
+ },
+ {
+ "nt1": "1.DG16",
+ "nt2": "1.DG24",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "1.DG17",
+ "nt2": "1.DG23",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "1.DG18",
+ "nt2": "1.DG22",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ }
+ ],
+ "helices": [
+ {
+ "quadruplexes": [
+ {
+ "tetrads": [
+ {
+ "id": "1.DG4-1.DG22-1.DG18-1.DG10",
+ "nt1": "1.DG4",
+ "nt2": "1.DG22",
+ "nt3": "1.DG18",
+ "nt4": "1.DG10",
+ "onz": "O-",
+ "gbaClassification": "Vb",
+ "planarityDeviation": 0.17372283960377805,
+ "ionsChannel": [],
+ "ionsOutside": []
+ },
+ {
+ "id": "1.DG5-1.DG23-1.DG17-1.DG11",
+ "nt1": "1.DG5",
+ "nt2": "1.DG23",
+ "nt3": "1.DG17",
+ "nt4": "1.DG11",
+ "onz": "O+",
+ "gbaClassification": "Va",
+ "planarityDeviation": 0.10474313820007483,
+ "ionsChannel": [],
+ "ionsOutside": []
+ },
+ {
+ "id": "1.DG6-1.DG24-1.DG16-1.DG12",
+ "nt1": "1.DG6",
+ "nt2": "1.DG24",
+ "nt3": "1.DG16",
+ "nt4": "1.DG12",
+ "onz": "O+",
+ "gbaClassification": "VIa",
+ "planarityDeviation": 0.18293509778060615,
+ "ionsChannel": [],
+ "ionsOutside": []
+ }
+ ],
+ "onzm": "Oh*",
+ "loopClassification": {
+ "classification": "9a",
+ "loopProgression": "-(pll)"
+ },
+ "gbaClassification": [
+ "V",
+ "VI"
+ ],
+ "tracts": [
+ [
+ "1.DG4",
+ "1.DG5",
+ "1.DG6"
+ ],
+ [
+ "1.DG22",
+ "1.DG23",
+ "1.DG24"
+ ],
+ [
+ "1.DG18",
+ "1.DG17",
+ "1.DG16"
+ ],
+ [
+ "1.DG10",
+ "1.DG11",
+ "1.DG12"
+ ]
+ ],
+ "loops": [
+ {
+ "type": "propeller-",
+ "nucleotides": [
+ "1.DT7",
+ "1.DT8",
+ "1.DA9"
+ ]
+ },
+ {
+ "type": "lateral-",
+ "nucleotides": [
+ "1.DT13",
+ "1.DT14",
+ "1.DA15"
+ ]
+ },
+ {
+ "type": "lateral+",
+ "nucleotides": [
+ "1.DT19",
+ "1.DT20",
+ "1.DA21"
+ ]
+ }
+ ]
+ }
+ ],
+ "tetradPairs": [
+ {
+ "tetrad1": "1.DG4-1.DG22-1.DG18-1.DG10",
+ "tetrad2": "1.DG5-1.DG23-1.DG17-1.DG11",
+ "direction": "hybrid",
+ "rise": 3.2109650905140654,
+ "twist": 16.228973729066034
+ },
+ {
+ "tetrad1": "1.DG5-1.DG23-1.DG17-1.DG11",
+ "tetrad2": "1.DG6-1.DG24-1.DG16-1.DG12",
+ "direction": "hybrid",
+ "rise": 3.1149939255558747,
+ "twist": 27.448958336697046
+ }
+ ]
+ }
+ ],
+ "dotBracket": {
+ "sequence": "AAAGGGTTAGGGTTAGGGTTAGGGAA",
+ "line1": "...([{...(((...)))...)]}..",
+ "line2": "...([{...)]}...(((...))).."
+ }
+}
+```
+
+</details>
+
+## 4RJ1: Structural variations and solvent structure of UGGGGU quadruplexes stabilized by Sr2+ ions
+
+![](4rj1.png)
+
+ $ curl https://www.ebi.ac.uk/pdbe/static/entry/download/4rj1-assembly-1.cif.gz | gzip -d > 4rj1-1.cif
+ $ ./eltetrado --input 4rj1-1.cif --output 4rj1-1.json
+
+ Chain order: A AB AA AC B BC BA BB
+ n4-helix with 10 tetrads
+ Op* VIII n/a quadruplex with 5 tetrads
+ A.U1006 AC.U1006 AA.U1006 AB.U1006 cWH cWH cWH cWH O- VIIIa planarity=1.06 ions_channel=NA ions_outside=A.U1006: [SR] AA.U1006: [SR] AB.U1006: [SR] AC.U1006: [SR]
+ direction=parallel rise=3.37 twist=39.96
+ A.G1005 AC.G1005 AA.G1005 AB.G1005 cHW cHW cHW cHW O+ VIIIa planarity=0.8
+ direction=parallel rise=3.31 twist=25.9
+ A.G1004 AC.G1004 AA.G1004 AB.G1004 cHW cHW cHW cHW O+ VIIIa planarity=0.41 ions_channel=SR
+ direction=parallel rise=3.34 twist=35.81
+ A.G1003 AC.G1003 AA.G1003 AB.G1003 cHW cHW cHW cHW O+ VIIIa planarity=0.55 ions_channel=SR
+ direction=parallel rise=3.29 twist=27.12
+ A.G1002 AC.G1002 AA.G1002 AB.G1002 cHW cHW cHW cHW O+ VIIIa planarity=0.54 ions_outside=AB.G1002: [CA] AC.G1002: [CA] AA.G1002: [CA] A.G1002: [CA]
+
+ Tracts:
+ A.U1006, A.G1005, A.G1004, A.G1003, A.G1002
+ AC.U1006, AC.G1005, AC.G1004, AC.G1003, AC.G1002
+ AA.U1006, AA.G1005, AA.G1004, AA.G1003, AA.G1002
+ AB.U1006, AB.G1005, AB.G1004, AB.G1003, AB.G1002
+
+ Op* VIII n/a quadruplex with 5 tetrads
+ B.G2002 BC.G2002 BA.G2002 BB.G2002 cWH cWH cWH cWH O+ VIIIa planarity=0.67
+ direction=parallel rise=3.37 twist=27.41
+ B.G2003 BC.G2003 BA.G2003 BB.G2003 cWH cWH cWH cWH O+ VIIIa planarity=0.58 ions_channel=SR ions_outside=B.G2003: [CA] BA.G2003: [CA] BB.G2003: [CA] BC.G2003: [CA]
+ direction=parallel rise=3.32 twist=35.04
+ B.G2004 BC.G2004 BA.G2004 BB.G2004 cWH cWH cWH cWH O+ VIIIa planarity=0.23 ions_channel=SR
+ direction=parallel rise=3.27 twist=25.15
+ B.G2005 BC.G2005 BA.G2005 BB.G2005 cWH cWH cWH cWH O+ VIIIa planarity=0.78 ions_channel=NA
+ direction=parallel rise=7.14 twist=43.41
+ B.U2006 BC.U2006 BA.U2006 BB.U2006 cHW cHW cHW cHW O- VIIIa planarity=1.58 ions_channel=NA,NA
+
+ Tracts:
+ B.G2002, B.G2003, B.G2004, B.G2005, B.U2006
+ BC.G2002, BC.G2003, BC.G2004, BC.G2005, BC.U2006
+ BA.G2002, BA.G2003, BA.G2004, BA.G2005, BA.U2006
+ BB.G2002, BB.G2003, BB.G2004, BB.G2005, BB.U2006
+
+ UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU
+ .([{<A-.([{<A-.)]}>a-.)]}>a-.([{<A-.)]}>a-.([{<A-.)]}>a
+ .([{<A-.)]}>a-.([{<A-.)]}>a-.([{<A-.([{<A-.)]}>a-.)]}>a
+
+<details>
+<summary>
+Click to see the output JSON
+</summary>
+
+``` json
+{
+ "metals": [
+ {
+ "symbol": "Sr",
+ "count": 8
+ },
+ {
+ "symbol": "Na",
+ "count": 4
+ },
+ {
+ "symbol": "Ca",
+ "count": 12
+ }
+ ],
+ "nucleotides": [
+ {
+ "index": 1,
+ "chain": "A",
+ "number": 1001,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "A.U1001",
+ "shortName": "U",
+ "chi": -141.92671313255752,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 2,
+ "chain": "A",
+ "number": 1002,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "A.G1002",
+ "shortName": "G",
+ "chi": -165.93034671112116,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 3,
+ "chain": "A",
+ "number": 1003,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "A.G1003",
+ "shortName": "G",
+ "chi": -121.5652426033226,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 4,
+ "chain": "A",
+ "number": 1004,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "A.G1004",
+ "shortName": "G",
+ "chi": -156.00957673923344,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 5,
+ "chain": "A",
+ "number": 1005,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "A.G1005",
+ "shortName": "G",
+ "chi": -148.10051684016415,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 6,
+ "chain": "A",
+ "number": 1006,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "A.U1006",
+ "shortName": "U",
+ "chi": -137.28005568139983,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 13,
+ "chain": "AA",
+ "number": 1001,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AA.U1001",
+ "shortName": "U",
+ "chi": -141.9267131325575,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 14,
+ "chain": "AA",
+ "number": 1002,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AA.G1002",
+ "shortName": "G",
+ "chi": -165.93034671112113,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 15,
+ "chain": "AA",
+ "number": 1003,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AA.G1003",
+ "shortName": "G",
+ "chi": -121.56524260332266,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 16,
+ "chain": "AA",
+ "number": 1004,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AA.G1004",
+ "shortName": "G",
+ "chi": -156.0095767392335,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 17,
+ "chain": "AA",
+ "number": 1005,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AA.G1005",
+ "shortName": "G",
+ "chi": -148.10051684016406,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 18,
+ "chain": "AA",
+ "number": 1006,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AA.U1006",
+ "shortName": "U",
+ "chi": -137.2800556813998,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 7,
+ "chain": "AB",
+ "number": 1001,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AB.U1001",
+ "shortName": "U",
+ "chi": -141.9267131325574,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 8,
+ "chain": "AB",
+ "number": 1002,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AB.G1002",
+ "shortName": "G",
+ "chi": -165.93034671112113,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 9,
+ "chain": "AB",
+ "number": 1003,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AB.G1003",
+ "shortName": "G",
+ "chi": -121.56524260332266,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 10,
+ "chain": "AB",
+ "number": 1004,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AB.G1004",
+ "shortName": "G",
+ "chi": -156.00957673923347,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 11,
+ "chain": "AB",
+ "number": 1005,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AB.G1005",
+ "shortName": "G",
+ "chi": -148.10051684016406,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 12,
+ "chain": "AB",
+ "number": 1006,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AB.U1006",
+ "shortName": "U",
+ "chi": -137.28005568139977,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 19,
+ "chain": "AC",
+ "number": 1001,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AC.U1001",
+ "shortName": "U",
+ "chi": -141.92671313255747,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 20,
+ "chain": "AC",
+ "number": 1002,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AC.G1002",
+ "shortName": "G",
+ "chi": -165.93034671112116,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 21,
+ "chain": "AC",
+ "number": 1003,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AC.G1003",
+ "shortName": "G",
+ "chi": -121.56524260332266,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 22,
+ "chain": "AC",
+ "number": 1004,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AC.G1004",
+ "shortName": "G",
+ "chi": -156.00957673923352,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 23,
+ "chain": "AC",
+ "number": 1005,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AC.G1005",
+ "shortName": "G",
+ "chi": -148.1005168401641,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 24,
+ "chain": "AC",
+ "number": 1006,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "AC.U1006",
+ "shortName": "U",
+ "chi": -137.28005568139986,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 25,
+ "chain": "B",
+ "number": 2001,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "B.U2001",
+ "shortName": "U",
+ "chi": -146.4615316869476,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 26,
+ "chain": "B",
+ "number": 2002,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "B.G2002",
+ "shortName": "G",
+ "chi": -170.79660912745996,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 27,
+ "chain": "B",
+ "number": 2003,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "B.G2003",
+ "shortName": "G",
+ "chi": -117.68718110874113,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 28,
+ "chain": "B",
+ "number": 2004,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "B.G2004",
+ "shortName": "G",
+ "chi": -153.88587375071324,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 29,
+ "chain": "B",
+ "number": 2005,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "B.G2005",
+ "shortName": "G",
+ "chi": -148.8519912845669,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 30,
+ "chain": "B",
+ "number": 2006,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "B.U2006",
+ "shortName": "U",
+ "chi": -159.43730655241544,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 37,
+ "chain": "BA",
+ "number": 2001,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BA.U2001",
+ "shortName": "U",
+ "chi": -146.46153168694764,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 38,
+ "chain": "BA",
+ "number": 2002,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BA.G2002",
+ "shortName": "G",
+ "chi": -170.79660912745993,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 39,
+ "chain": "BA",
+ "number": 2003,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BA.G2003",
+ "shortName": "G",
+ "chi": -117.68718110874113,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 40,
+ "chain": "BA",
+ "number": 2004,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BA.G2004",
+ "shortName": "G",
+ "chi": -153.88587375071322,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 41,
+ "chain": "BA",
+ "number": 2005,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BA.G2005",
+ "shortName": "G",
+ "chi": -148.851991284567,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 42,
+ "chain": "BA",
+ "number": 2006,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BA.U2006",
+ "shortName": "U",
+ "chi": -159.43730655241544,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 43,
+ "chain": "BB",
+ "number": 2001,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BB.U2001",
+ "shortName": "U",
+ "chi": -146.4615316869476,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 44,
+ "chain": "BB",
+ "number": 2002,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BB.G2002",
+ "shortName": "G",
+ "chi": -170.79660912745993,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 45,
+ "chain": "BB",
+ "number": 2003,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BB.G2003",
+ "shortName": "G",
+ "chi": -117.68718110874106,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 46,
+ "chain": "BB",
+ "number": 2004,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BB.G2004",
+ "shortName": "G",
+ "chi": -153.8858737507132,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 47,
+ "chain": "BB",
+ "number": 2005,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BB.G2005",
+ "shortName": "G",
+ "chi": -148.85199128456696,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 48,
+ "chain": "BB",
+ "number": 2006,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BB.U2006",
+ "shortName": "U",
+ "chi": -159.43730655241544,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 31,
+ "chain": "BC",
+ "number": 2001,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BC.U2001",
+ "shortName": "U",
+ "chi": -146.4615316869476,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 32,
+ "chain": "BC",
+ "number": 2002,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BC.G2002",
+ "shortName": "G",
+ "chi": -170.79660912745993,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 33,
+ "chain": "BC",
+ "number": 2003,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BC.G2003",
+ "shortName": "G",
+ "chi": -117.68718110874121,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 34,
+ "chain": "BC",
+ "number": 2004,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BC.G2004",
+ "shortName": "G",
+ "chi": -153.88587375071322,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 35,
+ "chain": "BC",
+ "number": 2005,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BC.G2005",
+ "shortName": "G",
+ "chi": -148.85199128456694,
+ "glycosidicBond": "anti"
+ },
+ {
+ "index": 36,
+ "chain": "BC",
+ "number": 2006,
+ "icode": null,
+ "molecule": "RNA",
+ "fullName": "BC.U2006",
+ "shortName": "U",
+ "chi": -159.43730655241544,
+ "glycosidicBond": "anti"
+ }
+ ],
+ "basePairs": [
+ {
+ "nt1": "A.G1002",
+ "nt2": "AB.G1002",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "A.G1002",
+ "nt2": "AC.G1002",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "A.G1003",
+ "nt2": "AB.G1003",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "A.G1003",
+ "nt2": "AC.G1003",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "A.G1004",
+ "nt2": "AB.G1004",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "A.G1004",
+ "nt2": "AC.G1004",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "A.G1005",
+ "nt2": "AB.G1005",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "A.G1005",
+ "nt2": "AC.G1005",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "A.U1006",
+ "nt2": "AB.U1006",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "A.U1006",
+ "nt2": "AC.U1006",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "AB.G1002",
+ "nt2": "AA.G1002",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "AA.G1002",
+ "nt2": "AC.G1002",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "AB.G1003",
+ "nt2": "AA.G1003",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "AA.G1003",
+ "nt2": "AC.G1003",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "AB.G1004",
+ "nt2": "AA.G1004",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "AA.G1004",
+ "nt2": "AC.G1004",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "AB.G1005",
+ "nt2": "AA.G1005",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "AA.G1005",
+ "nt2": "AC.G1005",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "AB.U1006",
+ "nt2": "AA.U1006",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "AA.U1006",
+ "nt2": "AC.U1006",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "B.G2002",
+ "nt2": "BB.G2002",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "B.G2002",
+ "nt2": "BC.G2002",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "B.G2003",
+ "nt2": "BB.G2003",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "B.G2003",
+ "nt2": "BC.G2003",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "B.G2004",
+ "nt2": "BB.G2004",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "B.G2004",
+ "nt2": "BC.G2004",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "B.G2005",
+ "nt2": "BB.G2005",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "B.G2005",
+ "nt2": "BC.G2005",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "B.U2006",
+ "nt2": "BB.U2006",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "B.U2006",
+ "nt2": "BC.U2006",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "BA.G2002",
+ "nt2": "BB.G2002",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "BC.G2002",
+ "nt2": "BA.G2002",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "BA.G2003",
+ "nt2": "BB.G2003",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "BC.G2003",
+ "nt2": "BA.G2003",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "BA.G2004",
+ "nt2": "BB.G2004",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "BC.G2004",
+ "nt2": "BA.G2004",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "BA.G2005",
+ "nt2": "BB.G2005",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "BC.G2005",
+ "nt2": "BA.G2005",
+ "lw": "cWH",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "BA.U2006",
+ "nt2": "BB.U2006",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ },
+ {
+ "nt1": "BC.U2006",
+ "nt2": "BA.U2006",
+ "lw": "cHW",
+ "inTetrad": true,
+ "canonical": false
+ }
+ ],
+ "helices": [
+ {
+ "quadruplexes": [
+ {
+ "tetrads": [
+ {
+ "id": "A.U1006-AC.U1006-AA.U1006-AB.U1006",
+ "nt1": "A.U1006",
+ "nt2": "AC.U1006",
+ "nt3": "AA.U1006",
+ "nt4": "AB.U1006",
+ "onz": "O-",
+ "gbaClassification": "VIIIa",
+ "planarityDeviation": 1.061,
+ "ionsChannel": [
+ "NA"
+ ],
+ "ionsOutside": [
+ {
+ "nt": "A.U1006",
+ "ion": "SR"
+ },
+ {
+ "nt": "AA.U1006",
+ "ion": "SR"
+ },
+ {
+ "nt": "AB.U1006",
+ "ion": "SR"
+ },
+ {
+ "nt": "AC.U1006",
+ "ion": "SR"
+ }
+ ]
+ },
+ {
+ "id": "A.G1005-AC.G1005-AA.G1005-AB.G1005",
+ "nt1": "A.G1005",
+ "nt2": "AC.G1005",
+ "nt3": "AA.G1005",
+ "nt4": "AB.G1005",
+ "onz": "O+",
+ "gbaClassification": "VIIIa",
+ "planarityDeviation": 0.7999999999999972,
+ "ionsChannel": [],
+ "ionsOutside": []
+ },
+ {
+ "id": "A.G1004-AC.G1004-AA.G1004-AB.G1004",
+ "nt1": "A.G1004",
+ "nt2": "AC.G1004",
+ "nt3": "AA.G1004",
+ "nt4": "AB.G1004",
+ "onz": "O+",
+ "gbaClassification": "VIIIa",
+ "planarityDeviation": 0.4059999999999988,
+ "ionsChannel": [
+ "SR"
+ ],
+ "ionsOutside": []
+ },
+ {
+ "id": "A.G1003-AC.G1003-AA.G1003-AB.G1003",
+ "nt1": "A.G1003",
+ "nt2": "AC.G1003",
+ "nt3": "AA.G1003",
+ "nt4": "AB.G1003",
+ "onz": "O+",
+ "gbaClassification": "VIIIa",
+ "planarityDeviation": 0.5549999999999997,
+ "ionsChannel": [
+ "SR"
+ ],
+ "ionsOutside": []
+ },
+ {
+ "id": "A.G1002-AC.G1002-AA.G1002-AB.G1002",
+ "nt1": "A.G1002",
+ "nt2": "AC.G1002",
+ "nt3": "AA.G1002",
+ "nt4": "AB.G1002",
+ "onz": "O+",
+ "gbaClassification": "VIIIa",
+ "planarityDeviation": 0.541999999999998,
+ "ionsChannel": [],
+ "ionsOutside": [
+ {
+ "nt": "AB.G1002",
+ "ion": "CA"
+ },
+ {
+ "nt": "AC.G1002",
+ "ion": "CA"
+ },
+ {
+ "nt": "AA.G1002",
+ "ion": "CA"
+ },
+ {
+ "nt": "A.G1002",
+ "ion": "CA"
+ }
+ ]
+ }
+ ],
+ "onzm": "Op*",
+ "loopClassification": null,
+ "gbaClassification": [
+ "VIII"
+ ],
+ "tracts": [
+ [
+ "A.U1006",
+ "A.G1005",
+ "A.G1004",
+ "A.G1003",
+ "A.G1002"
+ ],
+ [
+ "AC.U1006",
+ "AC.G1005",
+ "AC.G1004",
+ "AC.G1003",
+ "AC.G1002"
+ ],
+ [
+ "AA.U1006",
+ "AA.G1005",
+ "AA.G1004",
+ "AA.G1003",
+ "AA.G1002"
+ ],
+ [
+ "AB.U1006",
+ "AB.G1005",
+ "AB.G1004",
+ "AB.G1003",
+ "AB.G1002"
+ ]
+ ],
+ "loops": []
+ },
+ {
+ "tetrads": [
+ {
+ "id": "B.G2002-BC.G2002-BA.G2002-BB.G2002",
+ "nt1": "B.G2002",
+ "nt2": "BC.G2002",
+ "nt3": "BA.G2002",
+ "nt4": "BB.G2002",
+ "onz": "O+",
+ "gbaClassification": "VIIIa",
+ "planarityDeviation": 0.6730000000000018,
+ "ionsChannel": [],
+ "ionsOutside": []
+ },
+ {
+ "id": "B.G2003-BC.G2003-BA.G2003-BB.G2003",
+ "nt1": "B.G2003",
+ "nt2": "BC.G2003",
+ "nt3": "BA.G2003",
+ "nt4": "BB.G2003",
+ "onz": "O+",
+ "gbaClassification": "VIIIa",
+ "planarityDeviation": 0.5769999999999982,
+ "ionsChannel": [
+ "SR"
+ ],
+ "ionsOutside": [
+ {
+ "nt": "B.G2003",
+ "ion": "CA"
+ },
+ {
+ "nt": "BA.G2003",
+ "ion": "CA"
+ },
+ {
+ "nt": "BB.G2003",
+ "ion": "CA"
+ },
+ {
+ "nt": "BC.G2003",
+ "ion": "CA"
+ }
+ ]
+ },
+ {
+ "id": "B.G2004-BC.G2004-BA.G2004-BB.G2004",
+ "nt1": "B.G2004",
+ "nt2": "BC.G2004",
+ "nt3": "BA.G2004",
+ "nt4": "BB.G2004",
+ "onz": "O+",
+ "gbaClassification": "VIIIa",
+ "planarityDeviation": 0.2289999999999992,
+ "ionsChannel": [
+ "SR"
+ ],
+ "ionsOutside": []
+ },
+ {
+ "id": "B.G2005-BC.G2005-BA.G2005-BB.G2005",
+ "nt1": "B.G2005",
+ "nt2": "BC.G2005",
+ "nt3": "BA.G2005",
+ "nt4": "BB.G2005",
+ "onz": "O+",
+ "gbaClassification": "VIIIa",
+ "planarityDeviation": 0.7810000000000006,
+ "ionsChannel": [
+ "NA"
+ ],
+ "ionsOutside": []
+ },
+ {
+ "id": "B.U2006-BC.U2006-BA.U2006-BB.U2006",
+ "nt1": "B.U2006",
+ "nt2": "BC.U2006",
+ "nt3": "BA.U2006",
+ "nt4": "BB.U2006",
+ "onz": "O-",
+ "gbaClassification": "VIIIa",
+ "planarityDeviation": 1.5840000000000005,
+ "ionsChannel": [
+ "NA",
+ "NA"
+ ],
+ "ionsOutside": []
+ }
+ ],
+ "onzm": "Op*",
+ "loopClassification": null,
+ "gbaClassification": [
+ "VIII"
+ ],
+ "tracts": [
+ [
+ "B.G2002",
+ "B.G2003",
+ "B.G2004",
+ "B.G2005",
+ "B.U2006"
+ ],
+ [
+ "BC.G2002",
+ "BC.G2003",
+ "BC.G2004",
+ "BC.G2005",
+ "BC.U2006"
+ ],
+ [
+ "BA.G2002",
+ "BA.G2003",
+ "BA.G2004",
+ "BA.G2005",
+ "BA.U2006"
+ ],
+ [
+ "BB.G2002",
+ "BB.G2003",
+ "BB.G2004",
+ "BB.G2005",
+ "BB.U2006"
+ ]
+ ],
+ "loops": []
+ }
+ ],
+ "tetradPairs": [
+ {
+ "tetrad1": "A.U1006-AC.U1006-AA.U1006-AB.U1006",
+ "tetrad2": "A.G1005-AC.G1005-AA.G1005-AB.G1005",
+ "direction": "parallel",
+ "rise": 3.366499999999995,
+ "twist": 39.962531742191736
+ },
+ {
+ "tetrad1": "A.G1005-AC.G1005-AA.G1005-AB.G1005",
+ "tetrad2": "A.G1004-AC.G1004-AA.G1004-AB.G1004",
+ "direction": "parallel",
+ "rise": 3.308000000000007,
+ "twist": 25.89614444631925
+ },
+ {
+ "tetrad1": "A.G1004-AC.G1004-AA.G1004-AB.G1004",
+ "tetrad2": "A.G1003-AC.G1003-AA.G1003-AB.G1003",
+ "direction": "parallel",
+ "rise": 3.339499999999994,
+ "twist": 35.81115298630443
+ },
+ {
+ "tetrad1": "A.G1003-AC.G1003-AA.G1003-AB.G1003",
+ "tetrad2": "A.G1002-AC.G1002-AA.G1002-AB.G1002",
+ "direction": "parallel",
+ "rise": 3.2865,
+ "twist": 27.11515971986803
+ },
+ {
+ "tetrad1": "A.G1002-AC.G1002-AA.G1002-AB.G1002",
+ "tetrad2": "B.G2002-BC.G2002-BA.G2002-BB.G2002",
+ "direction": "parallel",
+ "rise": 3.369500000000002,
+ "twist": 28.993180312675573
+ },
+ {
+ "tetrad1": "B.G2002-BC.G2002-BA.G2002-BB.G2002",
+ "tetrad2": "B.G2003-BC.G2003-BA.G2003-BB.G2003",
+ "direction": "parallel",
+ "rise": 3.371000000000002,
+ "twist": 27.410084968596852
+ },
+ {
+ "tetrad1": "B.G2003-BC.G2003-BA.G2003-BB.G2003",
+ "tetrad2": "B.G2004-BC.G2004-BA.G2004-BB.G2004",
+ "direction": "parallel",
+ "rise": 3.318000000000005,
+ "twist": 35.04072146975963
+ },
+ {
+ "tetrad1": "B.G2004-BC.G2004-BA.G2004-BB.G2004",
+ "tetrad2": "B.G2005-BC.G2005-BA.G2005-BB.G2005",
+ "direction": "parallel",
+ "rise": 3.2689999999999966,
+ "twist": 25.149997949938147
+ },
+ {
+ "tetrad1": "B.G2005-BC.G2005-BA.G2005-BB.G2005",
+ "tetrad2": "B.U2006-BC.U2006-BA.U2006-BB.U2006",
+ "direction": "parallel",
+ "rise": 7.140499999999998,
+ "twist": 43.40609492262336
+ }
+ ]
+ }
+ ],
+ "dotBracket": {
+ "sequence": "UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU",
+ "line1": ".([{<A-.([{<A-.)]}>a-.)]}>a-.([{<A-.)]}>a-.([{<A-.)]}>a",
+ "line2": ".([{<A-.)]}>a-.([{<A-.)]}>a-.([{<A-.([{<A-.)]}>a-.)]}>a"
+ }
+}
+```
+
+</details>
+
+# Funding
+
+This research was supported by the National Science Centre, Poland
+\[2016/23/B/ST6/03931, 2019/35/B/ST6/03074\] and Mloda Kadra project
+\[09/91/SBAD/0684\] from Poznan University of Technology, and carried
+out in the European Centre for Bioinformatics and Genomics (Poland). The
+authors also acknowledge partial support by the statutory funds of
+Poznan University of Technology, Polish Ministry of Science and Higher
+Education, and the Institute of Bioorganic Chemistry, PAS within
+intramural financing program.
+
+# Bibliography
+
+<div id="refs" class="references csl-bib-body">
+
+1. Topology-Based Classification of Tetrads and Quadruplex
+ Structures. M. Popenda, J. Miskiewicz, J. Sarzynska, T. Zok, M.
+ Szachniuk. *Bioinformatics*. 2020. 36(4):1129–1134.
+ doi:[10.1093/bioinformatics/btz738](https://doi.org/10.1093/bioinformatics/btz738)
+
+2. ElTetrado: A Tool for Identification and Classification of Tetrads
+ and Quadruplexes. T. Zok, M. Popenda, M. Szachniuk. *BMC
+ Bioinformatics*. 2020. 21(1):40.
+ doi:[10.1186/s12859-020-3385-1](https://doi.org/10.1186/s12859-020-3385-1)
+
+3. R-Chie : A Web Server and R Package for Visualizing RNA Secondary
+ Structures. D. Lai, J.R. Proctor, J.Y.A. Zhu, I.M. Meyer. *Nucleic
+ Acids Research*. 2012. 40(12):e95.
+ doi:[f99845](https://doi.org/f99845)
+
+4. Geometric Nomenclature and Classification of RNA Base Pairs. N.B.
+ Leontis, E. Westhof. *RNA*. 2001. 7(4):499–512.
+ doi:[10.1017/s1355838201002515](https://doi.org/10.1017/s1355838201002515)
+
+</div>
+
+
+%prep
+%autosetup -n eltetrado-1.5.15
+
+%build
+%py3_build
+
+%install
+%py3_install
+install -d -m755 %{buildroot}/%{_pkgdocdir}
+if [ -d doc ]; then cp -arf doc %{buildroot}/%{_pkgdocdir}; fi
+if [ -d docs ]; then cp -arf docs %{buildroot}/%{_pkgdocdir}; fi
+if [ -d example ]; then cp -arf example %{buildroot}/%{_pkgdocdir}; fi
+if [ -d examples ]; then cp -arf examples %{buildroot}/%{_pkgdocdir}; fi
+pushd %{buildroot}
+if [ -d usr/lib ]; then
+ find usr/lib -type f -printf "/%h/%f\n" >> filelist.lst
+fi
+if [ -d usr/lib64 ]; then
+ find usr/lib64 -type f -printf "/%h/%f\n" >> filelist.lst
+fi
+if [ -d usr/bin ]; then
+ find usr/bin -type f -printf "/%h/%f\n" >> filelist.lst
+fi
+if [ -d usr/sbin ]; then
+ find usr/sbin -type f -printf "/%h/%f\n" >> filelist.lst
+fi
+touch doclist.lst
+if [ -d usr/share/man ]; then
+ find usr/share/man -type f -printf "/%h/%f.gz\n" >> doclist.lst
+fi
+popd
+mv %{buildroot}/filelist.lst .
+mv %{buildroot}/doclist.lst .
+
+%files -n python3-eltetrado -f filelist.lst
+%dir %{python3_sitelib}/*
+
+%files help -f doclist.lst
+%{_docdir}/*
+
+%changelog
+* Mon May 29 2023 Python_Bot <Python_Bot@openeuler.org> - 1.5.15-1
+- Package Spec generated
diff --git a/sources b/sources
new file mode 100644
index 0000000..5843887
--- /dev/null
+++ b/sources
@@ -0,0 +1 @@
+bd3197e3a59cc083882efafc4529d14f eltetrado-1.5.15.tar.gz