summaryrefslogtreecommitdiff
path: root/python-pydna.spec
diff options
context:
space:
mode:
Diffstat (limited to 'python-pydna.spec')
-rw-r--r--python-pydna.spec1099
1 files changed, 1099 insertions, 0 deletions
diff --git a/python-pydna.spec b/python-pydna.spec
new file mode 100644
index 0000000..79d3f7a
--- /dev/null
+++ b/python-pydna.spec
@@ -0,0 +1,1099 @@
+%global _empty_manifest_terminate_build 0
+Name: python-pydna
+Version: 5.2.0
+Release: 1
+Summary: Representing double stranded DNA and functions for simulating cloning and homologous recombination between DNA molecules.
+License: BSD
+URL: https://pypi.org/project/pydna/
+Source0: https://mirrors.nju.edu.cn/pypi/web/packages/84/da/0c926cecd9ea436f54b9ec2e3aa8ab6f71936ce5eb8be312db68ec0ce5a0/pydna-5.2.0.tar.gz
+BuildArch: noarch
+
+Requires: python3-appdirs
+Requires: python3-biopython
+Requires: python3-cai2
+Requires: python3-matplotlib
+Requires: python3-networkx
+Requires: python3-pillow
+Requires: python3-prettytable
+Requires: python3-pyfiglet
+Requires: python3-pyparsing
+Requires: python3-pyperclip
+Requires: python3-pyqt5
+Requires: python3-requests
+Requires: python3-scipy
+
+%description
+# ![icon](https://raw.githubusercontent.com/bjornFJohansson/pydna/master/docs/pics/pydna.resized.png) pydna
+
+| [![Tests & Coverage](https://github.com/BjornFJohansson/pydna/workflows/Tests%20&%20Coverage/badge.svg)](https://github.com/BjornFJohansson/pydna/actions?query=workflow%3A%22Tests+%26+Coverage%22) |[![codecov](https://codecov.io/gh/BjornFJohansson/pydna/branch/master/graph/badge.svg)](https://codecov.io/gh/BjornFJohansson/pydna/branch/master) | [![PyPI version](https://badge.fury.io/py/pydna.svg)](https://badge.fury.io/py/pydna) |[![Anaconda-Server Badge](https://anaconda.org/bjornfjohansson/pydna/badges/version.svg)](https://anaconda.org/bjornfjohansson/pydna) | [![Google group : pydna](https://img.shields.io/badge/Google%20Group-pydna-blue.svg)](https://groups.google.com/g/pydna) |
+|---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------|------------------------------------------------------------------------------------------------------------------------------------------------------|-----------------------------------------------------------------------------------------------------------------------------------------|----------------------------------------------------------------------------------------------------------------------------------------|---------------------------------------------------------------------------------------------------------------------------------|
+| [![Documentation Status](https://readthedocs.org/projects/pydna/badge/?version=latest)](http://pydna.readthedocs.io/?badge=latest) |[![GitHub issues](https://img.shields.io/github/issues/BjornFJohansson/pydna.svg)](https://github.com/BjornFJohansson/pydna/issues) | [![Anaconda-Server Badge2](https://anaconda.org/bjornfjohansson/pydna/badges/license.svg)](https://anaconda.org/bjornfjohansson/pydna) |[![GitHub stars](https://img.shields.io/github/stars/BjornFJohansson/pydna.svg)](https://github.com/BjornFJohansson/pydna/stargazers) | |
+
+
+Planning genetic constructs with many parts and assembly steps, such as recombinant
+metabolic pathways :petri_dish:, are often difficult to **properly** document as is evident from the poor
+state of documentation in the scientific literature :radioactive:.
+
+
+The pydna python package provide a human-readable formal descriptions of :dna: cloning and genetic assembly
+strategies in Python :snake: which allow for simulation and verification.
+
+
+Pydna can be used as [executable documentation](https://en.wikipedia.org/wiki/Literate_programming) for cloning.
+
+
+A cloning strategy expressed in pydna is **complete**, **unambiguous** and **stable**.
+
+
+Pydna provides simulation of:
+
+- Restriction digestion
+- Ligation
+- PCR
+- Primer design
+- Gibson assembly
+- Golden gate assembly
+- Homologous recombination
+- Gel electrophoresis of DNA with generation of gel images
+
+Virtually any sub-cloning experiment can be described in pydna, and its execution yield
+the sequences of intermediate and final DNA molecules.
+
+Pydna has been designed with the goal of being understandable for biologists with only some basic understanding of Python.
+
+Pydna can formalize planning and sharing of cloning strategies and is especially useful for complex or combinatorial
+DNA molecule constructions.
+
+
+To get started, we have compiled some [simple examples](https://github.com/MetabolicEngineeringGroupCBMA/pydna-examples#pydna-examples).
+For more elaborate use, look at some assembly strategies of D-xylose metabolic pathways [MetabolicEngineeringGroupCBMA/ypk-xylose-pathways](https://github.com/MetabolicEngineeringGroupCBMA/ypk-xylose-pathways#pereira-et-al-2016).
+
+
+
+
+
+![-----------------------------------------------------](https://raw.githubusercontent.com/andreasbm/readme/master/assets/lines/colored.png)
+
+
+
+## Usage
+
+Most pydna functionality is implemented as methods for the double stranded DNA sequence record
+classes Dseq and Dseqrecord, which are subclasses of the [Biopython](http://biopython.org/wiki/Main_Page) [Seq](http://biopython.org/wiki/Seq) and [SeqRecord](http://biopython.org/wiki/SeqRecord) classes.
+
+These classes make cut and paste cloning and PCR very simple:
+
+ >>> from pydna.dseq import Dseq
+ >>> seq = Dseq("GGATCCAAA","TTTGGATCC",ovhg=0)
+ >>> seq
+ Dseq(-9)
+ GGATCCAAA
+ CCTAGGTTT
+ >>> from Bio.Restriction import BamHI
+ >>> a,b = seq.cut(BamHI)
+ >>> a
+ Dseq(-5)
+ G
+ CCTAG
+ >>> b
+ Dseq(-8)
+ GATCCAAA
+ GTTT
+ >>> a+b
+ Dseq(-9)
+ GGATCCAAA
+ CCTAGGTTT
+ >>> b+a
+ Dseq(-13)
+ GATCCAAAG
+ GTTTCCTAG
+ >>> b+a+b
+ Dseq(-17)
+ GATCCAAAGGATCCAAA
+ GTTTCCTAGGTTT
+ >>> b+a+a
+ Traceback (most recent call last):
+ File "<stdin>", line 1, in <module>
+ File "/usr/local/lib/python2.7/dist-packages/pydna/dsdna.py", line 217, in __add__
+ raise TypeError("sticky ends not compatible!")
+ TypeError: sticky ends not compatible!
+ >>>
+
+As the example above shows, pydna keeps track of sticky ends.
+
+Notably, homologous recombination and Gibson assembly between linear DNA fragments
+can be easily simulated without any additional information besides the primary sequence of the fragments.
+
+Gel electrophoresis of DNA fragments can be simulated using the included gel module
+
+
+ Jupyter QtConsole 4.7.7
+ Python 3.8.5 | packaged by conda-forge | (default, Aug 29 2020, 01:22:49)
+ Type 'copyright', 'credits' or 'license' for more information
+ IPython 7.18.1 -- An enhanced Interactive Python. Type '?' for help.
+
+ In [1]: from pydna.gel import gel
+
+ In [2]: from pydna.ladders import PennStateLadder
+
+ In [3]: from pydna.dseqrecord import Dseqrecord
+
+ In [4]: gel([PennStateLadder,[Dseqrecord("A"*2000)]])
+ Out[4]:
+
+
+
+![](https://raw.githubusercontent.com/BjornFJohansson/pydna/master/scripts/pydna_gel.png)
+
+
+Pydna can be very compact. The eleven lines of Python below simulates the construction of a recombinant plasmid.
+DNA sequences are downloaded from Genbank by accession numbers that are guaranteed to be stable over time.
+
+ from pydna.genbank import Genbank
+ gb = Genbank("myself@email.com") # Tell Genbank who you are!
+ gene = gb.nucleotide("X06997") # Kluyveromyces lactis LAC12 gene for lactose permease.
+ from pydna.parsers import parse_primers
+ primer_f,primer_r = parse_primers(''' >760_KlLAC12_rv (20-mer)
+ ttaaacagattctgcctctg
+
+ >759_KlLAC12_fw (19-mer)
+ aaatggcagatcattcgag ''')
+ from pydna.amplify import pcr
+ pcr_prod = pcr(primer_f,primer_r, gene)
+ vector = gb.nucleotide("AJ001614") # pCAPs cloning vector
+ from Bio.Restriction import EcoRV
+ lin_vector = vector.linearize(EcoRV)
+ rec_vec = ( lin_vector + pcr_prod ).looped()
+
+Pydna can automate the simulation of [sub cloning](http://en.wikipedia.org/wiki/Subcloning) experiments using
+python. This is helpful to generate examples for teaching purposes.
+
+Read the documentation (below) or the [cookbook](https://github.com/BjornFJohansson/pydna/blob/master/docs/cookbook/cookbook.ipynb) with example files
+for further information.
+
+Please post a message in the [google group](https://groups.google.com/d/forum/pydna)
+for pydna if you need help or have problems, questions or comments :sos:.
+
+Feedback & suggestions are very welcome!
+
+![-----------------------------------------------------](https://raw.githubusercontent.com/andreasbm/readme/master/assets/lines/colored.png)
+
+
+## Who is using pydna?
+
+Taylor, L. J., & Strebel, K. (2017).
+Pyviko: an automated Python tool to design gene knockouts in complex viruses with overlapping genes.
+BMC Microbiology, 17(1), 12.
+[PubMed](https://www.ncbi.nlm.nih.gov/pubmed/28061810)
+
+
+Wang, Y., Xue, H., Pourcel, C., Du, Y., & Gautheret, D. (2021).
+2-kupl: mapping-free variant detection from DNA-seq data of matched samples.
+In Cold Spring Harbor Laboratory (p. 2021.01.17.427048). [DOI](https://doi.org/10.1101/2021.01.17.427048)
+[PubMed](https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8180056)
+
+
+[An Automated Protein Synthesis Pipeline with Transcriptic and Snakemake](http://blog.booleanbiotech.com/transcriptic_protein_synthesis_pipeline.html)
+
+
+and other projects on [github](https://github.com/BjornFJohansson/pydna/network/dependents?package_id=UGFja2FnZS01MjQ2MjYzNQ%3D%3D)
+
+![-----------------------------------------------------](https://raw.githubusercontent.com/andreasbm/readme/master/assets/lines/colored.png)
+
+There is an open access paper in BMC Bioinformatics describing pydna:
+
+[![abstr](https://raw.githubusercontent.com/bjornFJohansson/pydna/master/docs/pics/BMC_resized.png)](http://www.biomedcentral.com/1471-2105/16/142/abstract)
+
+Please reference the above paper:
+
+
+Pereira, F., Azevedo, F., Carvalho, Â., Ribeiro, G. F., Budde, M. W., & Johansson, B. (2015). Pydna: a simulation and documentation tool for DNA assembly strategies using python. BMC Bioinformatics, 16(142), 142.
+
+
+When using pydna.
+
+![-----------------------------------------------------](https://raw.githubusercontent.com/andreasbm/readme/master/assets/lines/colored.png)
+
+## Documentation
+
+Documentation is built using [Sphinx](http://www.sphinx-doc.org/) from [docstrings](https://www.python.org/dev/peps/pep-0257/)
+in the code and displayed at readthedocs [![Documentation Status](https://readthedocs.org/projects/pydna/badge/?version=latest)](http://pydna.readthedocs.io/?badge=latest)
+
+The [numpy](www.numpy.org) [docstring format](https://github.com/numpy/numpy/blob/release/doc/HOWTO_DOCUMENT.rst.txt) is used.
+
+![-----------------------------------------------------](https://raw.githubusercontent.com/andreasbm/readme/master/assets/lines/colored.png)
+
+## Installation using pip
+
+Pip is included in recent Python versions and is the
+officially [recommended](http://python-packaging-user-guide.readthedocs.org/en/latest) tool.
+
+Pip installs the minimal installation requirements automatically, but not the optional requirements (see below).
+
+ pip install pydna
+
+or use the --pre switch to get the latest version of pydna.
+
+ pip install pydna --pre
+
+for optional functionality do:
+
+ pip install pydna[gel,download,express,gui]
+
+Remove options inside the square brackets as required, but be sure not to leave spaces as pip will not recognize the options. See below under "Optional dependencies".
+
+### Windows:
+
+You should be able to pip install pydna from the Windows terminal as biopython now can be installed with pip as well.
+
+ C:\> pip install pydna
+
+By default python and pip are not on the PATH. You can re-install Python and select this option during installation, or give the full path for pip. Try something like this, depending on where your copy of Python is installed:
+
+ C:\Python37\Scripts\pip install pydna
+
+![-----------------------------------------------------](https://raw.githubusercontent.com/andreasbm/readme/master/assets/lines/colored.png)
+
+## Source Code
+
+Pydna is developed on [Github](https://github.com/BjornFJohansson/pydna) :octocat:.
+
+![-----------------------------------------------------](https://raw.githubusercontent.com/andreasbm/readme/master/assets/lines/colored.png)
+
+## Minimal installation dependencies
+
+Pydna versions before 1.0.0 were compatible with python 2.7 only.
+The list below is the minimal requirements for installing pydna.
+Biopython has c-extensions, but the other modules are pure python.
+
+- [Python 3.8, 3.9, 3.10 or 3.11](http://www.python.org)
+- [appdirs >=1.4.4](https://pypi.python.org/pypi/appdirs)
+- [biopython >= 1.80](http://pypi.python.org/pypi/biopython)
+- [networkx >=2.8.8](http://pypi.python.org/pypi/networkx)
+- [prettytable >=3.5.0](https://pypi.python.org/pypi/PrettyTable)
+- [pyperclip >=1.8.2](https://pypi.python.org/pypi/PrettyTable)
+- [pyfiglet >=0.8.post1](https://pypi.python.org/pypi/PrettyTable)
+
+
+## Optional dependencies
+
+If the modules listed below in the first column are installed, they will provide the functionality listed in the second column.
+
+| Dependency | Function in pydna |
+|-------------------------------------------------------------|--------------------------------------------------------|
+| [scipy >=1.8.0](https://www.scipy.org) | gel simulation with pydna.gel |
+| [matplotlib >=3.4.3](http://matplotlib.org) | “ |
+| [pillow >=8.4.0](https://github.com/python-pillow/Pillow) | “ |
+| [numpy](http://www.numpy.org) | " |
+| [pyparsing >=2.4.7](https://pypi.python.org/pypi/pyparsing) | fix corrupt Genbank files with pydna.genbankfixer |
+| [requests >=2.26.0](https://pypi.org/project/requests) | download sequences with pydna.download |
+| [cai2 >=1.0.5](https://pypi.python.org/pypi/cai2) | codon adaptation index calculations in several modules |
+| [pyqt5 >=5.15.0](https://pypi.python.org/pypi/pyqt5) | codon adaptation index calculations in several modules |
+
+
+## Requirements for running tests and analyzing code coverage
+
+- [pytest](https://pypi.org/project/pytest)
+- [pytest-cov](https://pypi.org/project/pytest-cov)
+- [pytest-doctestplus](https://pypi.org/project/pytest-doctestplus)
+- [coverage](https://pypi.org/project/coverage)
+- [nbval](https://pypi.org/project/nbval)
+- [requests-mock](https://pypi.org/project/requests-mock)
+
+![----](https://raw.githubusercontent.com/andreasbm/readme/master/assets/lines/colored.png)
+
+## Releases
+
+See the [releases](https://github.com/BjornFJohansson/pydna/releases) for changes and releases.
+
+![----](https://raw.githubusercontent.com/andreasbm/readme/master/assets/lines/colored.png)
+
+## Automatic testing & Release process
+
+There are three github actions associated with this package:
+
+- `pydna_test_and_coverage_workflow.yml`
+
+The `pydna_test_and_coverage_workflow.yml` is triggered on all pushed non-tagged commits.
+This workflow run tests, doctests and a series of Jupyter notebooks using pytest.
+
+The two other workflows build a setuptools wheel and packages for different Python versions
+on Linux, Windows and macOS.
+
+These are triggered by publishing a github release manually from the github interface.
+
+![----](https://raw.githubusercontent.com/andreasbm/readme/master/assets/lines/colored.png)
+
+## Building a PyPI package with [Poetry](https://pypi.org/project/poetry)
+
+1. Commit changes to git
+2. Tag the commit according to the [Semantic Versioning](https://semver.org) format, for example "v2.0.1a3". Do not forget the "v" or poetry will not recognize the tag.
+
+ git tag v2.0.1a3
+
+3. Pydna uses the poetry [poetry-dynamic-versioning](https://pypi.org/project/poetry-dynamic-versioning) plugin.
+
+ poetry dynamic-versioning # This sets the version number in the source files
+
+4. Verify the version
+
+ poetry version
+
+5. Build package:
+
+ poetry build # run this command in the root directory where the pyproject.toml file is located
+
+6. Verify the filename of the files in the dist/ folder, they should match
+
+7. Publish to pypi
+
+ poetry publish
+
+![----](https://raw.githubusercontent.com/andreasbm/readme/master/assets/lines/colored.png)
+
+## History
+
+Pydna was made public in 2012 on [Google code](https://code.google.com/archive/p/pydna).
+
+
+:microbe:
+
+
+:portugal:
+
+
+
+%package -n python3-pydna
+Summary: Representing double stranded DNA and functions for simulating cloning and homologous recombination between DNA molecules.
+Provides: python-pydna
+BuildRequires: python3-devel
+BuildRequires: python3-setuptools
+BuildRequires: python3-pip
+%description -n python3-pydna
+# ![icon](https://raw.githubusercontent.com/bjornFJohansson/pydna/master/docs/pics/pydna.resized.png) pydna
+
+| [![Tests & Coverage](https://github.com/BjornFJohansson/pydna/workflows/Tests%20&%20Coverage/badge.svg)](https://github.com/BjornFJohansson/pydna/actions?query=workflow%3A%22Tests+%26+Coverage%22) |[![codecov](https://codecov.io/gh/BjornFJohansson/pydna/branch/master/graph/badge.svg)](https://codecov.io/gh/BjornFJohansson/pydna/branch/master) | [![PyPI version](https://badge.fury.io/py/pydna.svg)](https://badge.fury.io/py/pydna) |[![Anaconda-Server Badge](https://anaconda.org/bjornfjohansson/pydna/badges/version.svg)](https://anaconda.org/bjornfjohansson/pydna) | [![Google group : pydna](https://img.shields.io/badge/Google%20Group-pydna-blue.svg)](https://groups.google.com/g/pydna) |
+|---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------|------------------------------------------------------------------------------------------------------------------------------------------------------|-----------------------------------------------------------------------------------------------------------------------------------------|----------------------------------------------------------------------------------------------------------------------------------------|---------------------------------------------------------------------------------------------------------------------------------|
+| [![Documentation Status](https://readthedocs.org/projects/pydna/badge/?version=latest)](http://pydna.readthedocs.io/?badge=latest) |[![GitHub issues](https://img.shields.io/github/issues/BjornFJohansson/pydna.svg)](https://github.com/BjornFJohansson/pydna/issues) | [![Anaconda-Server Badge2](https://anaconda.org/bjornfjohansson/pydna/badges/license.svg)](https://anaconda.org/bjornfjohansson/pydna) |[![GitHub stars](https://img.shields.io/github/stars/BjornFJohansson/pydna.svg)](https://github.com/BjornFJohansson/pydna/stargazers) | |
+
+
+Planning genetic constructs with many parts and assembly steps, such as recombinant
+metabolic pathways :petri_dish:, are often difficult to **properly** document as is evident from the poor
+state of documentation in the scientific literature :radioactive:.
+
+
+The pydna python package provide a human-readable formal descriptions of :dna: cloning and genetic assembly
+strategies in Python :snake: which allow for simulation and verification.
+
+
+Pydna can be used as [executable documentation](https://en.wikipedia.org/wiki/Literate_programming) for cloning.
+
+
+A cloning strategy expressed in pydna is **complete**, **unambiguous** and **stable**.
+
+
+Pydna provides simulation of:
+
+- Restriction digestion
+- Ligation
+- PCR
+- Primer design
+- Gibson assembly
+- Golden gate assembly
+- Homologous recombination
+- Gel electrophoresis of DNA with generation of gel images
+
+Virtually any sub-cloning experiment can be described in pydna, and its execution yield
+the sequences of intermediate and final DNA molecules.
+
+Pydna has been designed with the goal of being understandable for biologists with only some basic understanding of Python.
+
+Pydna can formalize planning and sharing of cloning strategies and is especially useful for complex or combinatorial
+DNA molecule constructions.
+
+
+To get started, we have compiled some [simple examples](https://github.com/MetabolicEngineeringGroupCBMA/pydna-examples#pydna-examples).
+For more elaborate use, look at some assembly strategies of D-xylose metabolic pathways [MetabolicEngineeringGroupCBMA/ypk-xylose-pathways](https://github.com/MetabolicEngineeringGroupCBMA/ypk-xylose-pathways#pereira-et-al-2016).
+
+
+
+
+
+![-----------------------------------------------------](https://raw.githubusercontent.com/andreasbm/readme/master/assets/lines/colored.png)
+
+
+
+## Usage
+
+Most pydna functionality is implemented as methods for the double stranded DNA sequence record
+classes Dseq and Dseqrecord, which are subclasses of the [Biopython](http://biopython.org/wiki/Main_Page) [Seq](http://biopython.org/wiki/Seq) and [SeqRecord](http://biopython.org/wiki/SeqRecord) classes.
+
+These classes make cut and paste cloning and PCR very simple:
+
+ >>> from pydna.dseq import Dseq
+ >>> seq = Dseq("GGATCCAAA","TTTGGATCC",ovhg=0)
+ >>> seq
+ Dseq(-9)
+ GGATCCAAA
+ CCTAGGTTT
+ >>> from Bio.Restriction import BamHI
+ >>> a,b = seq.cut(BamHI)
+ >>> a
+ Dseq(-5)
+ G
+ CCTAG
+ >>> b
+ Dseq(-8)
+ GATCCAAA
+ GTTT
+ >>> a+b
+ Dseq(-9)
+ GGATCCAAA
+ CCTAGGTTT
+ >>> b+a
+ Dseq(-13)
+ GATCCAAAG
+ GTTTCCTAG
+ >>> b+a+b
+ Dseq(-17)
+ GATCCAAAGGATCCAAA
+ GTTTCCTAGGTTT
+ >>> b+a+a
+ Traceback (most recent call last):
+ File "<stdin>", line 1, in <module>
+ File "/usr/local/lib/python2.7/dist-packages/pydna/dsdna.py", line 217, in __add__
+ raise TypeError("sticky ends not compatible!")
+ TypeError: sticky ends not compatible!
+ >>>
+
+As the example above shows, pydna keeps track of sticky ends.
+
+Notably, homologous recombination and Gibson assembly between linear DNA fragments
+can be easily simulated without any additional information besides the primary sequence of the fragments.
+
+Gel electrophoresis of DNA fragments can be simulated using the included gel module
+
+
+ Jupyter QtConsole 4.7.7
+ Python 3.8.5 | packaged by conda-forge | (default, Aug 29 2020, 01:22:49)
+ Type 'copyright', 'credits' or 'license' for more information
+ IPython 7.18.1 -- An enhanced Interactive Python. Type '?' for help.
+
+ In [1]: from pydna.gel import gel
+
+ In [2]: from pydna.ladders import PennStateLadder
+
+ In [3]: from pydna.dseqrecord import Dseqrecord
+
+ In [4]: gel([PennStateLadder,[Dseqrecord("A"*2000)]])
+ Out[4]:
+
+
+
+![](https://raw.githubusercontent.com/BjornFJohansson/pydna/master/scripts/pydna_gel.png)
+
+
+Pydna can be very compact. The eleven lines of Python below simulates the construction of a recombinant plasmid.
+DNA sequences are downloaded from Genbank by accession numbers that are guaranteed to be stable over time.
+
+ from pydna.genbank import Genbank
+ gb = Genbank("myself@email.com") # Tell Genbank who you are!
+ gene = gb.nucleotide("X06997") # Kluyveromyces lactis LAC12 gene for lactose permease.
+ from pydna.parsers import parse_primers
+ primer_f,primer_r = parse_primers(''' >760_KlLAC12_rv (20-mer)
+ ttaaacagattctgcctctg
+
+ >759_KlLAC12_fw (19-mer)
+ aaatggcagatcattcgag ''')
+ from pydna.amplify import pcr
+ pcr_prod = pcr(primer_f,primer_r, gene)
+ vector = gb.nucleotide("AJ001614") # pCAPs cloning vector
+ from Bio.Restriction import EcoRV
+ lin_vector = vector.linearize(EcoRV)
+ rec_vec = ( lin_vector + pcr_prod ).looped()
+
+Pydna can automate the simulation of [sub cloning](http://en.wikipedia.org/wiki/Subcloning) experiments using
+python. This is helpful to generate examples for teaching purposes.
+
+Read the documentation (below) or the [cookbook](https://github.com/BjornFJohansson/pydna/blob/master/docs/cookbook/cookbook.ipynb) with example files
+for further information.
+
+Please post a message in the [google group](https://groups.google.com/d/forum/pydna)
+for pydna if you need help or have problems, questions or comments :sos:.
+
+Feedback & suggestions are very welcome!
+
+![-----------------------------------------------------](https://raw.githubusercontent.com/andreasbm/readme/master/assets/lines/colored.png)
+
+
+## Who is using pydna?
+
+Taylor, L. J., & Strebel, K. (2017).
+Pyviko: an automated Python tool to design gene knockouts in complex viruses with overlapping genes.
+BMC Microbiology, 17(1), 12.
+[PubMed](https://www.ncbi.nlm.nih.gov/pubmed/28061810)
+
+
+Wang, Y., Xue, H., Pourcel, C., Du, Y., & Gautheret, D. (2021).
+2-kupl: mapping-free variant detection from DNA-seq data of matched samples.
+In Cold Spring Harbor Laboratory (p. 2021.01.17.427048). [DOI](https://doi.org/10.1101/2021.01.17.427048)
+[PubMed](https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8180056)
+
+
+[An Automated Protein Synthesis Pipeline with Transcriptic and Snakemake](http://blog.booleanbiotech.com/transcriptic_protein_synthesis_pipeline.html)
+
+
+and other projects on [github](https://github.com/BjornFJohansson/pydna/network/dependents?package_id=UGFja2FnZS01MjQ2MjYzNQ%3D%3D)
+
+![-----------------------------------------------------](https://raw.githubusercontent.com/andreasbm/readme/master/assets/lines/colored.png)
+
+There is an open access paper in BMC Bioinformatics describing pydna:
+
+[![abstr](https://raw.githubusercontent.com/bjornFJohansson/pydna/master/docs/pics/BMC_resized.png)](http://www.biomedcentral.com/1471-2105/16/142/abstract)
+
+Please reference the above paper:
+
+
+Pereira, F., Azevedo, F., Carvalho, Â., Ribeiro, G. F., Budde, M. W., & Johansson, B. (2015). Pydna: a simulation and documentation tool for DNA assembly strategies using python. BMC Bioinformatics, 16(142), 142.
+
+
+When using pydna.
+
+![-----------------------------------------------------](https://raw.githubusercontent.com/andreasbm/readme/master/assets/lines/colored.png)
+
+## Documentation
+
+Documentation is built using [Sphinx](http://www.sphinx-doc.org/) from [docstrings](https://www.python.org/dev/peps/pep-0257/)
+in the code and displayed at readthedocs [![Documentation Status](https://readthedocs.org/projects/pydna/badge/?version=latest)](http://pydna.readthedocs.io/?badge=latest)
+
+The [numpy](www.numpy.org) [docstring format](https://github.com/numpy/numpy/blob/release/doc/HOWTO_DOCUMENT.rst.txt) is used.
+
+![-----------------------------------------------------](https://raw.githubusercontent.com/andreasbm/readme/master/assets/lines/colored.png)
+
+## Installation using pip
+
+Pip is included in recent Python versions and is the
+officially [recommended](http://python-packaging-user-guide.readthedocs.org/en/latest) tool.
+
+Pip installs the minimal installation requirements automatically, but not the optional requirements (see below).
+
+ pip install pydna
+
+or use the --pre switch to get the latest version of pydna.
+
+ pip install pydna --pre
+
+for optional functionality do:
+
+ pip install pydna[gel,download,express,gui]
+
+Remove options inside the square brackets as required, but be sure not to leave spaces as pip will not recognize the options. See below under "Optional dependencies".
+
+### Windows:
+
+You should be able to pip install pydna from the Windows terminal as biopython now can be installed with pip as well.
+
+ C:\> pip install pydna
+
+By default python and pip are not on the PATH. You can re-install Python and select this option during installation, or give the full path for pip. Try something like this, depending on where your copy of Python is installed:
+
+ C:\Python37\Scripts\pip install pydna
+
+![-----------------------------------------------------](https://raw.githubusercontent.com/andreasbm/readme/master/assets/lines/colored.png)
+
+## Source Code
+
+Pydna is developed on [Github](https://github.com/BjornFJohansson/pydna) :octocat:.
+
+![-----------------------------------------------------](https://raw.githubusercontent.com/andreasbm/readme/master/assets/lines/colored.png)
+
+## Minimal installation dependencies
+
+Pydna versions before 1.0.0 were compatible with python 2.7 only.
+The list below is the minimal requirements for installing pydna.
+Biopython has c-extensions, but the other modules are pure python.
+
+- [Python 3.8, 3.9, 3.10 or 3.11](http://www.python.org)
+- [appdirs >=1.4.4](https://pypi.python.org/pypi/appdirs)
+- [biopython >= 1.80](http://pypi.python.org/pypi/biopython)
+- [networkx >=2.8.8](http://pypi.python.org/pypi/networkx)
+- [prettytable >=3.5.0](https://pypi.python.org/pypi/PrettyTable)
+- [pyperclip >=1.8.2](https://pypi.python.org/pypi/PrettyTable)
+- [pyfiglet >=0.8.post1](https://pypi.python.org/pypi/PrettyTable)
+
+
+## Optional dependencies
+
+If the modules listed below in the first column are installed, they will provide the functionality listed in the second column.
+
+| Dependency | Function in pydna |
+|-------------------------------------------------------------|--------------------------------------------------------|
+| [scipy >=1.8.0](https://www.scipy.org) | gel simulation with pydna.gel |
+| [matplotlib >=3.4.3](http://matplotlib.org) | “ |
+| [pillow >=8.4.0](https://github.com/python-pillow/Pillow) | “ |
+| [numpy](http://www.numpy.org) | " |
+| [pyparsing >=2.4.7](https://pypi.python.org/pypi/pyparsing) | fix corrupt Genbank files with pydna.genbankfixer |
+| [requests >=2.26.0](https://pypi.org/project/requests) | download sequences with pydna.download |
+| [cai2 >=1.0.5](https://pypi.python.org/pypi/cai2) | codon adaptation index calculations in several modules |
+| [pyqt5 >=5.15.0](https://pypi.python.org/pypi/pyqt5) | codon adaptation index calculations in several modules |
+
+
+## Requirements for running tests and analyzing code coverage
+
+- [pytest](https://pypi.org/project/pytest)
+- [pytest-cov](https://pypi.org/project/pytest-cov)
+- [pytest-doctestplus](https://pypi.org/project/pytest-doctestplus)
+- [coverage](https://pypi.org/project/coverage)
+- [nbval](https://pypi.org/project/nbval)
+- [requests-mock](https://pypi.org/project/requests-mock)
+
+![----](https://raw.githubusercontent.com/andreasbm/readme/master/assets/lines/colored.png)
+
+## Releases
+
+See the [releases](https://github.com/BjornFJohansson/pydna/releases) for changes and releases.
+
+![----](https://raw.githubusercontent.com/andreasbm/readme/master/assets/lines/colored.png)
+
+## Automatic testing & Release process
+
+There are three github actions associated with this package:
+
+- `pydna_test_and_coverage_workflow.yml`
+
+The `pydna_test_and_coverage_workflow.yml` is triggered on all pushed non-tagged commits.
+This workflow run tests, doctests and a series of Jupyter notebooks using pytest.
+
+The two other workflows build a setuptools wheel and packages for different Python versions
+on Linux, Windows and macOS.
+
+These are triggered by publishing a github release manually from the github interface.
+
+![----](https://raw.githubusercontent.com/andreasbm/readme/master/assets/lines/colored.png)
+
+## Building a PyPI package with [Poetry](https://pypi.org/project/poetry)
+
+1. Commit changes to git
+2. Tag the commit according to the [Semantic Versioning](https://semver.org) format, for example "v2.0.1a3". Do not forget the "v" or poetry will not recognize the tag.
+
+ git tag v2.0.1a3
+
+3. Pydna uses the poetry [poetry-dynamic-versioning](https://pypi.org/project/poetry-dynamic-versioning) plugin.
+
+ poetry dynamic-versioning # This sets the version number in the source files
+
+4. Verify the version
+
+ poetry version
+
+5. Build package:
+
+ poetry build # run this command in the root directory where the pyproject.toml file is located
+
+6. Verify the filename of the files in the dist/ folder, they should match
+
+7. Publish to pypi
+
+ poetry publish
+
+![----](https://raw.githubusercontent.com/andreasbm/readme/master/assets/lines/colored.png)
+
+## History
+
+Pydna was made public in 2012 on [Google code](https://code.google.com/archive/p/pydna).
+
+
+:microbe:
+
+
+:portugal:
+
+
+
+%package help
+Summary: Development documents and examples for pydna
+Provides: python3-pydna-doc
+%description help
+# ![icon](https://raw.githubusercontent.com/bjornFJohansson/pydna/master/docs/pics/pydna.resized.png) pydna
+
+| [![Tests & Coverage](https://github.com/BjornFJohansson/pydna/workflows/Tests%20&%20Coverage/badge.svg)](https://github.com/BjornFJohansson/pydna/actions?query=workflow%3A%22Tests+%26+Coverage%22) |[![codecov](https://codecov.io/gh/BjornFJohansson/pydna/branch/master/graph/badge.svg)](https://codecov.io/gh/BjornFJohansson/pydna/branch/master) | [![PyPI version](https://badge.fury.io/py/pydna.svg)](https://badge.fury.io/py/pydna) |[![Anaconda-Server Badge](https://anaconda.org/bjornfjohansson/pydna/badges/version.svg)](https://anaconda.org/bjornfjohansson/pydna) | [![Google group : pydna](https://img.shields.io/badge/Google%20Group-pydna-blue.svg)](https://groups.google.com/g/pydna) |
+|---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------|------------------------------------------------------------------------------------------------------------------------------------------------------|-----------------------------------------------------------------------------------------------------------------------------------------|----------------------------------------------------------------------------------------------------------------------------------------|---------------------------------------------------------------------------------------------------------------------------------|
+| [![Documentation Status](https://readthedocs.org/projects/pydna/badge/?version=latest)](http://pydna.readthedocs.io/?badge=latest) |[![GitHub issues](https://img.shields.io/github/issues/BjornFJohansson/pydna.svg)](https://github.com/BjornFJohansson/pydna/issues) | [![Anaconda-Server Badge2](https://anaconda.org/bjornfjohansson/pydna/badges/license.svg)](https://anaconda.org/bjornfjohansson/pydna) |[![GitHub stars](https://img.shields.io/github/stars/BjornFJohansson/pydna.svg)](https://github.com/BjornFJohansson/pydna/stargazers) | |
+
+
+Planning genetic constructs with many parts and assembly steps, such as recombinant
+metabolic pathways :petri_dish:, are often difficult to **properly** document as is evident from the poor
+state of documentation in the scientific literature :radioactive:.
+
+
+The pydna python package provide a human-readable formal descriptions of :dna: cloning and genetic assembly
+strategies in Python :snake: which allow for simulation and verification.
+
+
+Pydna can be used as [executable documentation](https://en.wikipedia.org/wiki/Literate_programming) for cloning.
+
+
+A cloning strategy expressed in pydna is **complete**, **unambiguous** and **stable**.
+
+
+Pydna provides simulation of:
+
+- Restriction digestion
+- Ligation
+- PCR
+- Primer design
+- Gibson assembly
+- Golden gate assembly
+- Homologous recombination
+- Gel electrophoresis of DNA with generation of gel images
+
+Virtually any sub-cloning experiment can be described in pydna, and its execution yield
+the sequences of intermediate and final DNA molecules.
+
+Pydna has been designed with the goal of being understandable for biologists with only some basic understanding of Python.
+
+Pydna can formalize planning and sharing of cloning strategies and is especially useful for complex or combinatorial
+DNA molecule constructions.
+
+
+To get started, we have compiled some [simple examples](https://github.com/MetabolicEngineeringGroupCBMA/pydna-examples#pydna-examples).
+For more elaborate use, look at some assembly strategies of D-xylose metabolic pathways [MetabolicEngineeringGroupCBMA/ypk-xylose-pathways](https://github.com/MetabolicEngineeringGroupCBMA/ypk-xylose-pathways#pereira-et-al-2016).
+
+
+
+
+
+![-----------------------------------------------------](https://raw.githubusercontent.com/andreasbm/readme/master/assets/lines/colored.png)
+
+
+
+## Usage
+
+Most pydna functionality is implemented as methods for the double stranded DNA sequence record
+classes Dseq and Dseqrecord, which are subclasses of the [Biopython](http://biopython.org/wiki/Main_Page) [Seq](http://biopython.org/wiki/Seq) and [SeqRecord](http://biopython.org/wiki/SeqRecord) classes.
+
+These classes make cut and paste cloning and PCR very simple:
+
+ >>> from pydna.dseq import Dseq
+ >>> seq = Dseq("GGATCCAAA","TTTGGATCC",ovhg=0)
+ >>> seq
+ Dseq(-9)
+ GGATCCAAA
+ CCTAGGTTT
+ >>> from Bio.Restriction import BamHI
+ >>> a,b = seq.cut(BamHI)
+ >>> a
+ Dseq(-5)
+ G
+ CCTAG
+ >>> b
+ Dseq(-8)
+ GATCCAAA
+ GTTT
+ >>> a+b
+ Dseq(-9)
+ GGATCCAAA
+ CCTAGGTTT
+ >>> b+a
+ Dseq(-13)
+ GATCCAAAG
+ GTTTCCTAG
+ >>> b+a+b
+ Dseq(-17)
+ GATCCAAAGGATCCAAA
+ GTTTCCTAGGTTT
+ >>> b+a+a
+ Traceback (most recent call last):
+ File "<stdin>", line 1, in <module>
+ File "/usr/local/lib/python2.7/dist-packages/pydna/dsdna.py", line 217, in __add__
+ raise TypeError("sticky ends not compatible!")
+ TypeError: sticky ends not compatible!
+ >>>
+
+As the example above shows, pydna keeps track of sticky ends.
+
+Notably, homologous recombination and Gibson assembly between linear DNA fragments
+can be easily simulated without any additional information besides the primary sequence of the fragments.
+
+Gel electrophoresis of DNA fragments can be simulated using the included gel module
+
+
+ Jupyter QtConsole 4.7.7
+ Python 3.8.5 | packaged by conda-forge | (default, Aug 29 2020, 01:22:49)
+ Type 'copyright', 'credits' or 'license' for more information
+ IPython 7.18.1 -- An enhanced Interactive Python. Type '?' for help.
+
+ In [1]: from pydna.gel import gel
+
+ In [2]: from pydna.ladders import PennStateLadder
+
+ In [3]: from pydna.dseqrecord import Dseqrecord
+
+ In [4]: gel([PennStateLadder,[Dseqrecord("A"*2000)]])
+ Out[4]:
+
+
+
+![](https://raw.githubusercontent.com/BjornFJohansson/pydna/master/scripts/pydna_gel.png)
+
+
+Pydna can be very compact. The eleven lines of Python below simulates the construction of a recombinant plasmid.
+DNA sequences are downloaded from Genbank by accession numbers that are guaranteed to be stable over time.
+
+ from pydna.genbank import Genbank
+ gb = Genbank("myself@email.com") # Tell Genbank who you are!
+ gene = gb.nucleotide("X06997") # Kluyveromyces lactis LAC12 gene for lactose permease.
+ from pydna.parsers import parse_primers
+ primer_f,primer_r = parse_primers(''' >760_KlLAC12_rv (20-mer)
+ ttaaacagattctgcctctg
+
+ >759_KlLAC12_fw (19-mer)
+ aaatggcagatcattcgag ''')
+ from pydna.amplify import pcr
+ pcr_prod = pcr(primer_f,primer_r, gene)
+ vector = gb.nucleotide("AJ001614") # pCAPs cloning vector
+ from Bio.Restriction import EcoRV
+ lin_vector = vector.linearize(EcoRV)
+ rec_vec = ( lin_vector + pcr_prod ).looped()
+
+Pydna can automate the simulation of [sub cloning](http://en.wikipedia.org/wiki/Subcloning) experiments using
+python. This is helpful to generate examples for teaching purposes.
+
+Read the documentation (below) or the [cookbook](https://github.com/BjornFJohansson/pydna/blob/master/docs/cookbook/cookbook.ipynb) with example files
+for further information.
+
+Please post a message in the [google group](https://groups.google.com/d/forum/pydna)
+for pydna if you need help or have problems, questions or comments :sos:.
+
+Feedback & suggestions are very welcome!
+
+![-----------------------------------------------------](https://raw.githubusercontent.com/andreasbm/readme/master/assets/lines/colored.png)
+
+
+## Who is using pydna?
+
+Taylor, L. J., & Strebel, K. (2017).
+Pyviko: an automated Python tool to design gene knockouts in complex viruses with overlapping genes.
+BMC Microbiology, 17(1), 12.
+[PubMed](https://www.ncbi.nlm.nih.gov/pubmed/28061810)
+
+
+Wang, Y., Xue, H., Pourcel, C., Du, Y., & Gautheret, D. (2021).
+2-kupl: mapping-free variant detection from DNA-seq data of matched samples.
+In Cold Spring Harbor Laboratory (p. 2021.01.17.427048). [DOI](https://doi.org/10.1101/2021.01.17.427048)
+[PubMed](https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8180056)
+
+
+[An Automated Protein Synthesis Pipeline with Transcriptic and Snakemake](http://blog.booleanbiotech.com/transcriptic_protein_synthesis_pipeline.html)
+
+
+and other projects on [github](https://github.com/BjornFJohansson/pydna/network/dependents?package_id=UGFja2FnZS01MjQ2MjYzNQ%3D%3D)
+
+![-----------------------------------------------------](https://raw.githubusercontent.com/andreasbm/readme/master/assets/lines/colored.png)
+
+There is an open access paper in BMC Bioinformatics describing pydna:
+
+[![abstr](https://raw.githubusercontent.com/bjornFJohansson/pydna/master/docs/pics/BMC_resized.png)](http://www.biomedcentral.com/1471-2105/16/142/abstract)
+
+Please reference the above paper:
+
+
+Pereira, F., Azevedo, F., Carvalho, Â., Ribeiro, G. F., Budde, M. W., & Johansson, B. (2015). Pydna: a simulation and documentation tool for DNA assembly strategies using python. BMC Bioinformatics, 16(142), 142.
+
+
+When using pydna.
+
+![-----------------------------------------------------](https://raw.githubusercontent.com/andreasbm/readme/master/assets/lines/colored.png)
+
+## Documentation
+
+Documentation is built using [Sphinx](http://www.sphinx-doc.org/) from [docstrings](https://www.python.org/dev/peps/pep-0257/)
+in the code and displayed at readthedocs [![Documentation Status](https://readthedocs.org/projects/pydna/badge/?version=latest)](http://pydna.readthedocs.io/?badge=latest)
+
+The [numpy](www.numpy.org) [docstring format](https://github.com/numpy/numpy/blob/release/doc/HOWTO_DOCUMENT.rst.txt) is used.
+
+![-----------------------------------------------------](https://raw.githubusercontent.com/andreasbm/readme/master/assets/lines/colored.png)
+
+## Installation using pip
+
+Pip is included in recent Python versions and is the
+officially [recommended](http://python-packaging-user-guide.readthedocs.org/en/latest) tool.
+
+Pip installs the minimal installation requirements automatically, but not the optional requirements (see below).
+
+ pip install pydna
+
+or use the --pre switch to get the latest version of pydna.
+
+ pip install pydna --pre
+
+for optional functionality do:
+
+ pip install pydna[gel,download,express,gui]
+
+Remove options inside the square brackets as required, but be sure not to leave spaces as pip will not recognize the options. See below under "Optional dependencies".
+
+### Windows:
+
+You should be able to pip install pydna from the Windows terminal as biopython now can be installed with pip as well.
+
+ C:\> pip install pydna
+
+By default python and pip are not on the PATH. You can re-install Python and select this option during installation, or give the full path for pip. Try something like this, depending on where your copy of Python is installed:
+
+ C:\Python37\Scripts\pip install pydna
+
+![-----------------------------------------------------](https://raw.githubusercontent.com/andreasbm/readme/master/assets/lines/colored.png)
+
+## Source Code
+
+Pydna is developed on [Github](https://github.com/BjornFJohansson/pydna) :octocat:.
+
+![-----------------------------------------------------](https://raw.githubusercontent.com/andreasbm/readme/master/assets/lines/colored.png)
+
+## Minimal installation dependencies
+
+Pydna versions before 1.0.0 were compatible with python 2.7 only.
+The list below is the minimal requirements for installing pydna.
+Biopython has c-extensions, but the other modules are pure python.
+
+- [Python 3.8, 3.9, 3.10 or 3.11](http://www.python.org)
+- [appdirs >=1.4.4](https://pypi.python.org/pypi/appdirs)
+- [biopython >= 1.80](http://pypi.python.org/pypi/biopython)
+- [networkx >=2.8.8](http://pypi.python.org/pypi/networkx)
+- [prettytable >=3.5.0](https://pypi.python.org/pypi/PrettyTable)
+- [pyperclip >=1.8.2](https://pypi.python.org/pypi/PrettyTable)
+- [pyfiglet >=0.8.post1](https://pypi.python.org/pypi/PrettyTable)
+
+
+## Optional dependencies
+
+If the modules listed below in the first column are installed, they will provide the functionality listed in the second column.
+
+| Dependency | Function in pydna |
+|-------------------------------------------------------------|--------------------------------------------------------|
+| [scipy >=1.8.0](https://www.scipy.org) | gel simulation with pydna.gel |
+| [matplotlib >=3.4.3](http://matplotlib.org) | “ |
+| [pillow >=8.4.0](https://github.com/python-pillow/Pillow) | “ |
+| [numpy](http://www.numpy.org) | " |
+| [pyparsing >=2.4.7](https://pypi.python.org/pypi/pyparsing) | fix corrupt Genbank files with pydna.genbankfixer |
+| [requests >=2.26.0](https://pypi.org/project/requests) | download sequences with pydna.download |
+| [cai2 >=1.0.5](https://pypi.python.org/pypi/cai2) | codon adaptation index calculations in several modules |
+| [pyqt5 >=5.15.0](https://pypi.python.org/pypi/pyqt5) | codon adaptation index calculations in several modules |
+
+
+## Requirements for running tests and analyzing code coverage
+
+- [pytest](https://pypi.org/project/pytest)
+- [pytest-cov](https://pypi.org/project/pytest-cov)
+- [pytest-doctestplus](https://pypi.org/project/pytest-doctestplus)
+- [coverage](https://pypi.org/project/coverage)
+- [nbval](https://pypi.org/project/nbval)
+- [requests-mock](https://pypi.org/project/requests-mock)
+
+![----](https://raw.githubusercontent.com/andreasbm/readme/master/assets/lines/colored.png)
+
+## Releases
+
+See the [releases](https://github.com/BjornFJohansson/pydna/releases) for changes and releases.
+
+![----](https://raw.githubusercontent.com/andreasbm/readme/master/assets/lines/colored.png)
+
+## Automatic testing & Release process
+
+There are three github actions associated with this package:
+
+- `pydna_test_and_coverage_workflow.yml`
+
+The `pydna_test_and_coverage_workflow.yml` is triggered on all pushed non-tagged commits.
+This workflow run tests, doctests and a series of Jupyter notebooks using pytest.
+
+The two other workflows build a setuptools wheel and packages for different Python versions
+on Linux, Windows and macOS.
+
+These are triggered by publishing a github release manually from the github interface.
+
+![----](https://raw.githubusercontent.com/andreasbm/readme/master/assets/lines/colored.png)
+
+## Building a PyPI package with [Poetry](https://pypi.org/project/poetry)
+
+1. Commit changes to git
+2. Tag the commit according to the [Semantic Versioning](https://semver.org) format, for example "v2.0.1a3". Do not forget the "v" or poetry will not recognize the tag.
+
+ git tag v2.0.1a3
+
+3. Pydna uses the poetry [poetry-dynamic-versioning](https://pypi.org/project/poetry-dynamic-versioning) plugin.
+
+ poetry dynamic-versioning # This sets the version number in the source files
+
+4. Verify the version
+
+ poetry version
+
+5. Build package:
+
+ poetry build # run this command in the root directory where the pyproject.toml file is located
+
+6. Verify the filename of the files in the dist/ folder, they should match
+
+7. Publish to pypi
+
+ poetry publish
+
+![----](https://raw.githubusercontent.com/andreasbm/readme/master/assets/lines/colored.png)
+
+## History
+
+Pydna was made public in 2012 on [Google code](https://code.google.com/archive/p/pydna).
+
+
+:microbe:
+
+
+:portugal:
+
+
+
+%prep
+%autosetup -n pydna-5.2.0
+
+%build
+%py3_build
+
+%install
+%py3_install
+install -d -m755 %{buildroot}/%{_pkgdocdir}
+if [ -d doc ]; then cp -arf doc %{buildroot}/%{_pkgdocdir}; fi
+if [ -d docs ]; then cp -arf docs %{buildroot}/%{_pkgdocdir}; fi
+if [ -d example ]; then cp -arf example %{buildroot}/%{_pkgdocdir}; fi
+if [ -d examples ]; then cp -arf examples %{buildroot}/%{_pkgdocdir}; fi
+pushd %{buildroot}
+if [ -d usr/lib ]; then
+ find usr/lib -type f -printf "/%h/%f\n" >> filelist.lst
+fi
+if [ -d usr/lib64 ]; then
+ find usr/lib64 -type f -printf "/%h/%f\n" >> filelist.lst
+fi
+if [ -d usr/bin ]; then
+ find usr/bin -type f -printf "/%h/%f\n" >> filelist.lst
+fi
+if [ -d usr/sbin ]; then
+ find usr/sbin -type f -printf "/%h/%f\n" >> filelist.lst
+fi
+touch doclist.lst
+if [ -d usr/share/man ]; then
+ find usr/share/man -type f -printf "/%h/%f.gz\n" >> doclist.lst
+fi
+popd
+mv %{buildroot}/filelist.lst .
+mv %{buildroot}/doclist.lst .
+
+%files -n python3-pydna -f filelist.lst
+%dir %{python3_sitelib}/*
+
+%files help -f doclist.lst
+%{_docdir}/*
+
+%changelog
+* Wed May 10 2023 Python_Bot <Python_Bot@openeuler.org> - 5.2.0-1
+- Package Spec generated