automatic import of python-taxoniqopeneuler20.03

3 files changed, 677 insertions, 0 deletions

diff --git a/.gitignore b/.gitignore
index e69de29..3c85478 100644
--- a/.gitignore
+++ b/.gitignore
@@ -0,0 +1 @@
+/taxoniq-0.6.0.tar.gz
diff --git a/python-taxoniq.spec b/python-taxoniq.spec
new file mode 100644
index 0000000..1e6a50e
--- /dev/null
+++ b/python-taxoniq.spec
@@ -0,0 +1,675 @@
+%global _empty_manifest_terminate_build 0
+Name:		python-taxoniq
+Version:	0.6.0
+Release:	1
+Summary:	Taxoniq: Taxon Information Query - fast, offline querying of NCBI Taxonomy and related data
+License:	MIT License
+URL:		https://github.com/chanzuckerberg/taxoniq
+Source0:	https://mirrors.nju.edu.cn/pypi/web/packages/ba/ca/0bd0a5f005c2fb057fb4901caae1d00fe24f6bcc15ad3b2b276ca87eaf8f/taxoniq-0.6.0.tar.gz
+BuildArch:	noarch
+
+Requires:	python3-zstandard
+Requires:	python3-urllib3
+Requires:	python3-ncbi-taxon-db
+
+%description
+Taxoniq is a Python and command-line interface to the
+[NCBI Taxonomy database](https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7408187/) and selected data sources that
+cross-reference it.
+Taxoniq's features include:
+- Pre-computed indexes updated monthly from NCBI, [WoL](https://biocore.github.io/wol/) and cross-referenced databases
+- Offline operation: all indexes are bundled with the package; no network calls are made when querying taxon information
+  (separately, Taxoniq can fetch the nucleotide or protein sequences over the network given a taxon or sequence
+  accession ID - see **Retrieving sequences** below)
+- A CLI capable of JSON I/O, batch processing and streaming of inputs for ease of use and pipelining in shell scripts
+- A stable, [well-documented](https://chanzuckerberg.github.io/taxoniq/#module-taxoniq), type-hinted Python API
+  (Python 3.6 and higher is supported)
+- Comprehensive testing and continuous integration
+- An intuitive interface with useful defaults
+- Compactness, readability, and extensibility
+The Taxoniq package bundles an indexed, compressed copy of the
+[NCBI taxonomy database files](https://ncbiinsights.ncbi.nlm.nih.gov/2018/02/22/new-taxonomy-files-available-with-lineage-type-and-host-information/),
+the [NCBI RefSeq](https://www.ncbi.nlm.nih.gov/refseq/) nucleotide and protein sequence accession IDs associated with
+each taxon, the [WoL](https://biocore.github.io/wol/) kingdom-wide phylogenomic distance database, and relevant
+information from other databases. Sequence accession IDs which appear in the NCBI RefSeq BLAST databases are indexed so
+that given a taxon ID, accession ID, or taxon name, you can quickly retrieve the taxon's rank, lineage, description,
+citations, representative RefSeq IDs, LCA information, evolutionary distance, sequence (with a network call), and more,
+as described in the **Cookbook** section below. Full [API documentation](https://chanzuckerberg.github.io/taxoniq/#module-taxoniq)
+is available.
+## Installation
+    pip3 install taxoniq
+Pre-built wheels are available for Python 3.5+ on Linux and MacOS. On MacOS 11 Big Sur, Pip 20.3+ is required to install
+pre-built wheels (you can check your version with `pip3 --version` and upgrade with `pip3 install --upgrade pip`).
+## Synopsis
+```python
+>>> import taxoniq
+>>> t = taxoniq.Taxon(9606)
+>>> t.scientific_name
+'Homo sapiens'
+>>> t.common_name
+'human'
+>>> t.ranked_lineage
+[taxoniq.Taxon(9606), taxoniq.Taxon(9605), taxoniq.Taxon(9604), taxoniq.Taxon(9443),
+ taxoniq.Taxon(40674), taxoniq.Taxon(7711), taxoniq.Taxon(33208), taxoniq.Taxon(2759)]
+>>> len(t.lineage)
+32
+>>> [(t.rank.name, t.scientific_name) for t in t.ranked_lineage]
+[('species', 'Homo sapiens'), ('genus', 'Homo'), ('family', 'Hominidae'), ('order', 'Primates'),
+ ('class', 'Mammalia'), ('phylum', 'Chordata'), ('kingdom', 'Metazoa'), ('superkingdom', 'Eukaryota')]
+>>> [(c.rank.name, c.common_name) for c in t.child_nodes]
+[('subspecies', 'Neandertal'), ('subspecies', 'Denisova hominin')]
+>>> t.refseq_representative_genome_accessions[:10]
+[taxoniq.Accession('NC_000001.11'), taxoniq.Accession('NC_000002.12'), taxoniq.Accession('NC_000003.12'),
+ taxoniq.Accession('NC_000004.12'), taxoniq.Accession('NC_000005.10'), taxoniq.Accession('NC_000006.12'),
+ taxoniq.Accession('NC_000007.14'), taxoniq.Accession('NC_000008.11'), taxoniq.Accession('NC_000009.12'),
+ taxoniq.Accession('NC_000010.11')]
+>>> t.url
+'https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9606'
+# Wikidata provides structured links to many databases about taxa represented on Wikipedia
+>>> t.wikidata_url
+'https://www.wikidata.org/wiki/Q15978631'
+```
+```
+>>> t2 = taxoniq.Taxon(scientific_name="Bacillus anthracis")
+>>> t2.description
+'<p class="mw-empty-elt"> </p> <p class="mw-empty-elt"> </p> <p><i><b>Bacillus anthracis</b></i>
+ is the agent of anthrax—a common disease of livestock and, occasionally, of humans—and the only
+ obligate pathogen within the genus <i>Bacillus</i>. This disease can be classified as a zoonosis,
+ causing infected animals to transmit the disease to humans. <i>B. anthracis</i> is a Gram-positive,
+ endospore-forming, rod-shaped bacterium, with a width of 1.0–1.2 µm and a length of 3–5&#160;µm.
+ It can be grown in an ordinary nutrient medium under aerobic or anaerobic conditions.</p>
+ <p>It is one of few bacteria known to synthesize a protein capsule (poly-D-gamma-glutamic acid).
+ Like <i>Bordetella pertussis</i>, it forms a calmodulin-dependent adenylate cyclase exotoxin known
+ as anthrax edema factor, along with anthrax lethal factor. It bears close genotypic and phenotypic
+ resemblance to <i>Bacillus cereus</i> and <i>Bacillus thuringiensis</i>. All three species share
+ cellular dimensions and morphology</p>...'
+```
+```python
+>>> t3 = taxoniq.Taxon(accession_id="NC_000913.3")
+>>> t3.scientific_name
+'Escherichia coli str. K-12 substr. MG1655"'
+>>> t3.parent.parent.common_name
+'E. coli'
+>>> t3.refseq_representative_genome_accessions[0].length
+4641652
+# The get_from_s3() method is the only command that will trigger a network call.
+>>> seq = t3.refseq_representative_genome_accessions[0].get_from_s3().read()
+>>> len(seq)
+4641652
+>>> seq[:64]
+b'AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGAT'
+```
+## Retrieving sequences
+Mirrors of the NCBI BLAST databases are maintained on [AWS S3](https://registry.opendata.aws/ncbi-blast-databases/)
+(`s3://ncbi-blast-databases`) and Google Storage (`gs://blast-db`). This is a key resource, since S3 and GS have
+superior bandwidth and throughput compared to the NCBI FTP server, so range requests can be used to retrieve individual
+sequences from the database files without downloading and keeping a copy of the whole database.
+The Taxoniq PyPI distribution (the package you install using `pip3 install taxoniq`) indexes sequence accession IDs for
+the following NCBI BLAST databases:
+- Refseq viruses representative genomes (`ref_viruses_rep_genomes`) (nucleotide)
+- Refseq prokaryote representative genomes (contains refseq assembly) (`ref_prok_rep_genomes`) (nucleotide)
+- RefSeq Eukaryotic Representative Genome Database (`ref_euk_rep_genomes`) (nucleotide)
+- Betacoronavirus (nucleotide)
+Given an accession ID, Taxoniq can issue a single HTTP request and return a file-like object streaming the nucleotide
+sequence from the S3 or GS mirror as follows:
+```python
+with taxoniq.Accession("NC_000913.3").get_from_s3() as fh:
+    fh.read()
+```
+For brevity, you can use [urllib3.response.HTTPResponse.stream](https://urllib3.readthedocs.io/en/latest/advanced-usage.html)
+instead of `read(...)` to avoid holding the entire sequence in memory:
+```python
+with taxoniq.Accession("NC_000913.3").get_from_s3() as fh:
+    for chunk in fh.stream():
+        sys.stdout.buffer.write(chunk)
+```
+To retrieve many sequences quickly, you may want to use a threadpool to open multiple network connections at once:
+```python
+from concurrent.futures import ThreadPoolExecutor
+def fetch_seq(accession):
+    seq = accession.get_from_s3().read()
+    return (accession, seq)
+taxon = taxoniq.Taxon(scientific_name="Apis mellifera")
+for accession, seq in ThreadPoolExecutor().map(fetch_seq, taxon.refseq_representative_genome_accessions):
+    print(accession, len(seq))
+```
+This operation is also available in the CLI, as described below.
+## Command-line interface
+`pip3 install taxoniq` installs a command-line utility, `taxoniq`, which can be used to perform many of the same
+functions provided by the Python API:
+```
+>taxoniq child-nodes --taxon-id 2 --output-format '{tax_id}: {scientific_name}'
+[
+    "1224: Proteobacteria",
+    "2323: Bacteria incertae sedis",
+    "32066: Fusobacteria",
+    "40117: Nitrospirae",
+    "48479: environmental samples",
+    "49928: unclassified Bacteria",
+    "57723: Acidobacteria",
+    "68297: Dictyoglomi",
+    "74152: Elusimicrobia",
+    "200783: Aquificae",
+    "200918: Thermotogae",
+    "200930: Deferribacteres",
+    "200938: Chrysiogenetes",
+    "200940: Thermodesulfobacteria",
+    "203691: Spirochaetes",
+    "508458: Synergistetes",
+    "1783257: PVC group",
+    "1783270: FCB group",
+    "1783272: Terrabacteria group",
+    "1802340: Nitrospinae/Tectomicrobia group",
+    "1930617: Calditrichaeota",
+    "2138240: Coprothermobacterota",
+    "2498710: Caldiserica/Cryosericota group",
+    "2698788: Candidatus Krumholzibacteriota",
+    "2716431: Coleospermum",
+    "2780997: Vogosella"
+]
+```
+See `taxoniq --help` for full details.
+#### Retrieving sequences using the CLI
+To retrieve an individual sequence in FASTA format given an accession ID, use `taxoniq get-from-s3 --accession-id ACCESSION_ID`.
+To retrieve multiple sequences in FASTA format, use `--accession-id -` and pass the IDs on standard input, one per line:
+`taxoniq refseq-representative-genome-accessions --scientific-name="Apis mellifera" | jq -r .[] | taxoniq get-from-s3 --accession-id -`.
+## Using the nr/nt databases
+Because of their size, taxoniq wheels with indexes of the NT (GenBank Non-redundant nucleotide) BLAST database are
+distributed on GitHub instead of PyPI. After running `pip3 install taxoniq`, you can install the NT indexes as follows:
+- Navigate to https://github.com/chanzuckerberg/taxoniq/releases/latest
+- In the "Assets" section, for each link that starts with "ncbi_genbank" and ends with ".whl":
+  - Right-click on the asset link, and click "Copy link address"
+  - Run `pip3 install --upgrade <PASTED LINK ADDRESS>`
+The NT index packages also contain indexes for the RefSeq representative genomes and Betacoronavirus accessions (meaning
+they are are superset of the PyPI packages).
+## Streaming CLI I/O
+The `taxoniq` command-line interface can take streaming input from stdin and produce streaming output on stdout. This
+allows the amortization of startup and index load time and efficient operation as part of shell pipelines.
+The following
+example shows the pipelined operation of [fastp](https://github.com/OpenGene/fastp),
+[kraken2](https://github.com/DerrickWood/kraken2/wiki), and taxoniq to annotate hits found in a Betacoronavirus sample:
+```
+in progress
+```
+<!--
+fastp --thread $KRAKEN2_NUM_THREADS --low_complexity_filter -i R1.fastq.gz -I R2.fastq.gz -o filtered.R1.fastq.gz -O filtered.R2.fastq.gz
+kraken2 --paired nohuman_1.fastq nohuman_2.fastq --classified-out 'classified#.fastq' | taxoniq
+-->
+## Cookbook
+In progress
+## Links
+* [Project home page (GitHub)](https://github.com/chanzuckerberg/taxoniq)
+* [Documentation](https://chanzuckerberg.github.io/taxoniq/)
+* [Package distribution (PyPI)](https://pypi.python.org/pypi/taxoniq)
+* [Change log](https://github.com/chanzuckerberg/taxoniq/blob/master/Changes.rst)
+* [ETE Toolkit](http://etetoolkit.org/) and the [ETE Tutorial](http://etetoolkit.org/docs/latest/tutorial/index.html) - a general purpose
+  phylogenetic tree toolkit with a rich Python interface
+## License
+Taxoniq software is licensed under the terms of the [MIT License](LICENSE).
+Distributions of this package contain data from
+[NCBI Taxonomy, NCBI GenBank, and NCBI RefSeq](https://www.ncbi.nlm.nih.gov/) (Bethesda (MD): National Library of
+Medicine (US), National Center for Biotechnology Information). These data are released into the public domain under the
+[NCBI Public Domain Notice](LICENSE.NCBI).
+Distributions of this package contain text excerpts from Wikipedia licensed under the terms of the
+[CC-BY-SA License](LICENSE.WIKIPEDIA).
+## Bugs
+Please report bugs, issues, feature requests, etc. on [GitHub](https://github.com/chanzuckerberg/taxoniq/issues).
+
+%package -n python3-taxoniq
+Summary:	Taxoniq: Taxon Information Query - fast, offline querying of NCBI Taxonomy and related data
+Provides:	python-taxoniq
+BuildRequires:	python3-devel
+BuildRequires:	python3-setuptools
+BuildRequires:	python3-pip
+%description -n python3-taxoniq
+Taxoniq is a Python and command-line interface to the
+[NCBI Taxonomy database](https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7408187/) and selected data sources that
+cross-reference it.
+Taxoniq's features include:
+- Pre-computed indexes updated monthly from NCBI, [WoL](https://biocore.github.io/wol/) and cross-referenced databases
+- Offline operation: all indexes are bundled with the package; no network calls are made when querying taxon information
+  (separately, Taxoniq can fetch the nucleotide or protein sequences over the network given a taxon or sequence
+  accession ID - see **Retrieving sequences** below)
+- A CLI capable of JSON I/O, batch processing and streaming of inputs for ease of use and pipelining in shell scripts
+- A stable, [well-documented](https://chanzuckerberg.github.io/taxoniq/#module-taxoniq), type-hinted Python API
+  (Python 3.6 and higher is supported)
+- Comprehensive testing and continuous integration
+- An intuitive interface with useful defaults
+- Compactness, readability, and extensibility
+The Taxoniq package bundles an indexed, compressed copy of the
+[NCBI taxonomy database files](https://ncbiinsights.ncbi.nlm.nih.gov/2018/02/22/new-taxonomy-files-available-with-lineage-type-and-host-information/),
+the [NCBI RefSeq](https://www.ncbi.nlm.nih.gov/refseq/) nucleotide and protein sequence accession IDs associated with
+each taxon, the [WoL](https://biocore.github.io/wol/) kingdom-wide phylogenomic distance database, and relevant
+information from other databases. Sequence accession IDs which appear in the NCBI RefSeq BLAST databases are indexed so
+that given a taxon ID, accession ID, or taxon name, you can quickly retrieve the taxon's rank, lineage, description,
+citations, representative RefSeq IDs, LCA information, evolutionary distance, sequence (with a network call), and more,
+as described in the **Cookbook** section below. Full [API documentation](https://chanzuckerberg.github.io/taxoniq/#module-taxoniq)
+is available.
+## Installation
+    pip3 install taxoniq
+Pre-built wheels are available for Python 3.5+ on Linux and MacOS. On MacOS 11 Big Sur, Pip 20.3+ is required to install
+pre-built wheels (you can check your version with `pip3 --version` and upgrade with `pip3 install --upgrade pip`).
+## Synopsis
+```python
+>>> import taxoniq
+>>> t = taxoniq.Taxon(9606)
+>>> t.scientific_name
+'Homo sapiens'
+>>> t.common_name
+'human'
+>>> t.ranked_lineage
+[taxoniq.Taxon(9606), taxoniq.Taxon(9605), taxoniq.Taxon(9604), taxoniq.Taxon(9443),
+ taxoniq.Taxon(40674), taxoniq.Taxon(7711), taxoniq.Taxon(33208), taxoniq.Taxon(2759)]
+>>> len(t.lineage)
+32
+>>> [(t.rank.name, t.scientific_name) for t in t.ranked_lineage]
+[('species', 'Homo sapiens'), ('genus', 'Homo'), ('family', 'Hominidae'), ('order', 'Primates'),
+ ('class', 'Mammalia'), ('phylum', 'Chordata'), ('kingdom', 'Metazoa'), ('superkingdom', 'Eukaryota')]
+>>> [(c.rank.name, c.common_name) for c in t.child_nodes]
+[('subspecies', 'Neandertal'), ('subspecies', 'Denisova hominin')]
+>>> t.refseq_representative_genome_accessions[:10]
+[taxoniq.Accession('NC_000001.11'), taxoniq.Accession('NC_000002.12'), taxoniq.Accession('NC_000003.12'),
+ taxoniq.Accession('NC_000004.12'), taxoniq.Accession('NC_000005.10'), taxoniq.Accession('NC_000006.12'),
+ taxoniq.Accession('NC_000007.14'), taxoniq.Accession('NC_000008.11'), taxoniq.Accession('NC_000009.12'),
+ taxoniq.Accession('NC_000010.11')]
+>>> t.url
+'https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9606'
+# Wikidata provides structured links to many databases about taxa represented on Wikipedia
+>>> t.wikidata_url
+'https://www.wikidata.org/wiki/Q15978631'
+```
+```
+>>> t2 = taxoniq.Taxon(scientific_name="Bacillus anthracis")
+>>> t2.description
+'<p class="mw-empty-elt"> </p> <p class="mw-empty-elt"> </p> <p><i><b>Bacillus anthracis</b></i>
+ is the agent of anthrax—a common disease of livestock and, occasionally, of humans—and the only
+ obligate pathogen within the genus <i>Bacillus</i>. This disease can be classified as a zoonosis,
+ causing infected animals to transmit the disease to humans. <i>B. anthracis</i> is a Gram-positive,
+ endospore-forming, rod-shaped bacterium, with a width of 1.0–1.2 µm and a length of 3–5&#160;µm.
+ It can be grown in an ordinary nutrient medium under aerobic or anaerobic conditions.</p>
+ <p>It is one of few bacteria known to synthesize a protein capsule (poly-D-gamma-glutamic acid).
+ Like <i>Bordetella pertussis</i>, it forms a calmodulin-dependent adenylate cyclase exotoxin known
+ as anthrax edema factor, along with anthrax lethal factor. It bears close genotypic and phenotypic
+ resemblance to <i>Bacillus cereus</i> and <i>Bacillus thuringiensis</i>. All three species share
+ cellular dimensions and morphology</p>...'
+```
+```python
+>>> t3 = taxoniq.Taxon(accession_id="NC_000913.3")
+>>> t3.scientific_name
+'Escherichia coli str. K-12 substr. MG1655"'
+>>> t3.parent.parent.common_name
+'E. coli'
+>>> t3.refseq_representative_genome_accessions[0].length
+4641652
+# The get_from_s3() method is the only command that will trigger a network call.
+>>> seq = t3.refseq_representative_genome_accessions[0].get_from_s3().read()
+>>> len(seq)
+4641652
+>>> seq[:64]
+b'AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGAT'
+```
+## Retrieving sequences
+Mirrors of the NCBI BLAST databases are maintained on [AWS S3](https://registry.opendata.aws/ncbi-blast-databases/)
+(`s3://ncbi-blast-databases`) and Google Storage (`gs://blast-db`). This is a key resource, since S3 and GS have
+superior bandwidth and throughput compared to the NCBI FTP server, so range requests can be used to retrieve individual
+sequences from the database files without downloading and keeping a copy of the whole database.
+The Taxoniq PyPI distribution (the package you install using `pip3 install taxoniq`) indexes sequence accession IDs for
+the following NCBI BLAST databases:
+- Refseq viruses representative genomes (`ref_viruses_rep_genomes`) (nucleotide)
+- Refseq prokaryote representative genomes (contains refseq assembly) (`ref_prok_rep_genomes`) (nucleotide)
+- RefSeq Eukaryotic Representative Genome Database (`ref_euk_rep_genomes`) (nucleotide)
+- Betacoronavirus (nucleotide)
+Given an accession ID, Taxoniq can issue a single HTTP request and return a file-like object streaming the nucleotide
+sequence from the S3 or GS mirror as follows:
+```python
+with taxoniq.Accession("NC_000913.3").get_from_s3() as fh:
+    fh.read()
+```
+For brevity, you can use [urllib3.response.HTTPResponse.stream](https://urllib3.readthedocs.io/en/latest/advanced-usage.html)
+instead of `read(...)` to avoid holding the entire sequence in memory:
+```python
+with taxoniq.Accession("NC_000913.3").get_from_s3() as fh:
+    for chunk in fh.stream():
+        sys.stdout.buffer.write(chunk)
+```
+To retrieve many sequences quickly, you may want to use a threadpool to open multiple network connections at once:
+```python
+from concurrent.futures import ThreadPoolExecutor
+def fetch_seq(accession):
+    seq = accession.get_from_s3().read()
+    return (accession, seq)
+taxon = taxoniq.Taxon(scientific_name="Apis mellifera")
+for accession, seq in ThreadPoolExecutor().map(fetch_seq, taxon.refseq_representative_genome_accessions):
+    print(accession, len(seq))
+```
+This operation is also available in the CLI, as described below.
+## Command-line interface
+`pip3 install taxoniq` installs a command-line utility, `taxoniq`, which can be used to perform many of the same
+functions provided by the Python API:
+```
+>taxoniq child-nodes --taxon-id 2 --output-format '{tax_id}: {scientific_name}'
+[
+    "1224: Proteobacteria",
+    "2323: Bacteria incertae sedis",
+    "32066: Fusobacteria",
+    "40117: Nitrospirae",
+    "48479: environmental samples",
+    "49928: unclassified Bacteria",
+    "57723: Acidobacteria",
+    "68297: Dictyoglomi",
+    "74152: Elusimicrobia",
+    "200783: Aquificae",
+    "200918: Thermotogae",
+    "200930: Deferribacteres",
+    "200938: Chrysiogenetes",
+    "200940: Thermodesulfobacteria",
+    "203691: Spirochaetes",
+    "508458: Synergistetes",
+    "1783257: PVC group",
+    "1783270: FCB group",
+    "1783272: Terrabacteria group",
+    "1802340: Nitrospinae/Tectomicrobia group",
+    "1930617: Calditrichaeota",
+    "2138240: Coprothermobacterota",
+    "2498710: Caldiserica/Cryosericota group",
+    "2698788: Candidatus Krumholzibacteriota",
+    "2716431: Coleospermum",
+    "2780997: Vogosella"
+]
+```
+See `taxoniq --help` for full details.
+#### Retrieving sequences using the CLI
+To retrieve an individual sequence in FASTA format given an accession ID, use `taxoniq get-from-s3 --accession-id ACCESSION_ID`.
+To retrieve multiple sequences in FASTA format, use `--accession-id -` and pass the IDs on standard input, one per line:
+`taxoniq refseq-representative-genome-accessions --scientific-name="Apis mellifera" | jq -r .[] | taxoniq get-from-s3 --accession-id -`.
+## Using the nr/nt databases
+Because of their size, taxoniq wheels with indexes of the NT (GenBank Non-redundant nucleotide) BLAST database are
+distributed on GitHub instead of PyPI. After running `pip3 install taxoniq`, you can install the NT indexes as follows:
+- Navigate to https://github.com/chanzuckerberg/taxoniq/releases/latest
+- In the "Assets" section, for each link that starts with "ncbi_genbank" and ends with ".whl":
+  - Right-click on the asset link, and click "Copy link address"
+  - Run `pip3 install --upgrade <PASTED LINK ADDRESS>`
+The NT index packages also contain indexes for the RefSeq representative genomes and Betacoronavirus accessions (meaning
+they are are superset of the PyPI packages).
+## Streaming CLI I/O
+The `taxoniq` command-line interface can take streaming input from stdin and produce streaming output on stdout. This
+allows the amortization of startup and index load time and efficient operation as part of shell pipelines.
+The following
+example shows the pipelined operation of [fastp](https://github.com/OpenGene/fastp),
+[kraken2](https://github.com/DerrickWood/kraken2/wiki), and taxoniq to annotate hits found in a Betacoronavirus sample:
+```
+in progress
+```
+<!--
+fastp --thread $KRAKEN2_NUM_THREADS --low_complexity_filter -i R1.fastq.gz -I R2.fastq.gz -o filtered.R1.fastq.gz -O filtered.R2.fastq.gz
+kraken2 --paired nohuman_1.fastq nohuman_2.fastq --classified-out 'classified#.fastq' | taxoniq
+-->
+## Cookbook
+In progress
+## Links
+* [Project home page (GitHub)](https://github.com/chanzuckerberg/taxoniq)
+* [Documentation](https://chanzuckerberg.github.io/taxoniq/)
+* [Package distribution (PyPI)](https://pypi.python.org/pypi/taxoniq)
+* [Change log](https://github.com/chanzuckerberg/taxoniq/blob/master/Changes.rst)
+* [ETE Toolkit](http://etetoolkit.org/) and the [ETE Tutorial](http://etetoolkit.org/docs/latest/tutorial/index.html) - a general purpose
+  phylogenetic tree toolkit with a rich Python interface
+## License
+Taxoniq software is licensed under the terms of the [MIT License](LICENSE).
+Distributions of this package contain data from
+[NCBI Taxonomy, NCBI GenBank, and NCBI RefSeq](https://www.ncbi.nlm.nih.gov/) (Bethesda (MD): National Library of
+Medicine (US), National Center for Biotechnology Information). These data are released into the public domain under the
+[NCBI Public Domain Notice](LICENSE.NCBI).
+Distributions of this package contain text excerpts from Wikipedia licensed under the terms of the
+[CC-BY-SA License](LICENSE.WIKIPEDIA).
+## Bugs
+Please report bugs, issues, feature requests, etc. on [GitHub](https://github.com/chanzuckerberg/taxoniq/issues).
+
+%package help
+Summary:	Development documents and examples for taxoniq
+Provides:	python3-taxoniq-doc
+%description help
+Taxoniq is a Python and command-line interface to the
+[NCBI Taxonomy database](https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7408187/) and selected data sources that
+cross-reference it.
+Taxoniq's features include:
+- Pre-computed indexes updated monthly from NCBI, [WoL](https://biocore.github.io/wol/) and cross-referenced databases
+- Offline operation: all indexes are bundled with the package; no network calls are made when querying taxon information
+  (separately, Taxoniq can fetch the nucleotide or protein sequences over the network given a taxon or sequence
+  accession ID - see **Retrieving sequences** below)
+- A CLI capable of JSON I/O, batch processing and streaming of inputs for ease of use and pipelining in shell scripts
+- A stable, [well-documented](https://chanzuckerberg.github.io/taxoniq/#module-taxoniq), type-hinted Python API
+  (Python 3.6 and higher is supported)
+- Comprehensive testing and continuous integration
+- An intuitive interface with useful defaults
+- Compactness, readability, and extensibility
+The Taxoniq package bundles an indexed, compressed copy of the
+[NCBI taxonomy database files](https://ncbiinsights.ncbi.nlm.nih.gov/2018/02/22/new-taxonomy-files-available-with-lineage-type-and-host-information/),
+the [NCBI RefSeq](https://www.ncbi.nlm.nih.gov/refseq/) nucleotide and protein sequence accession IDs associated with
+each taxon, the [WoL](https://biocore.github.io/wol/) kingdom-wide phylogenomic distance database, and relevant
+information from other databases. Sequence accession IDs which appear in the NCBI RefSeq BLAST databases are indexed so
+that given a taxon ID, accession ID, or taxon name, you can quickly retrieve the taxon's rank, lineage, description,
+citations, representative RefSeq IDs, LCA information, evolutionary distance, sequence (with a network call), and more,
+as described in the **Cookbook** section below. Full [API documentation](https://chanzuckerberg.github.io/taxoniq/#module-taxoniq)
+is available.
+## Installation
+    pip3 install taxoniq
+Pre-built wheels are available for Python 3.5+ on Linux and MacOS. On MacOS 11 Big Sur, Pip 20.3+ is required to install
+pre-built wheels (you can check your version with `pip3 --version` and upgrade with `pip3 install --upgrade pip`).
+## Synopsis
+```python
+>>> import taxoniq
+>>> t = taxoniq.Taxon(9606)
+>>> t.scientific_name
+'Homo sapiens'
+>>> t.common_name
+'human'
+>>> t.ranked_lineage
+[taxoniq.Taxon(9606), taxoniq.Taxon(9605), taxoniq.Taxon(9604), taxoniq.Taxon(9443),
+ taxoniq.Taxon(40674), taxoniq.Taxon(7711), taxoniq.Taxon(33208), taxoniq.Taxon(2759)]
+>>> len(t.lineage)
+32
+>>> [(t.rank.name, t.scientific_name) for t in t.ranked_lineage]
+[('species', 'Homo sapiens'), ('genus', 'Homo'), ('family', 'Hominidae'), ('order', 'Primates'),
+ ('class', 'Mammalia'), ('phylum', 'Chordata'), ('kingdom', 'Metazoa'), ('superkingdom', 'Eukaryota')]
+>>> [(c.rank.name, c.common_name) for c in t.child_nodes]
+[('subspecies', 'Neandertal'), ('subspecies', 'Denisova hominin')]
+>>> t.refseq_representative_genome_accessions[:10]
+[taxoniq.Accession('NC_000001.11'), taxoniq.Accession('NC_000002.12'), taxoniq.Accession('NC_000003.12'),
+ taxoniq.Accession('NC_000004.12'), taxoniq.Accession('NC_000005.10'), taxoniq.Accession('NC_000006.12'),
+ taxoniq.Accession('NC_000007.14'), taxoniq.Accession('NC_000008.11'), taxoniq.Accession('NC_000009.12'),
+ taxoniq.Accession('NC_000010.11')]
+>>> t.url
+'https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9606'
+# Wikidata provides structured links to many databases about taxa represented on Wikipedia
+>>> t.wikidata_url
+'https://www.wikidata.org/wiki/Q15978631'
+```
+```
+>>> t2 = taxoniq.Taxon(scientific_name="Bacillus anthracis")
+>>> t2.description
+'<p class="mw-empty-elt"> </p> <p class="mw-empty-elt"> </p> <p><i><b>Bacillus anthracis</b></i>
+ is the agent of anthrax—a common disease of livestock and, occasionally, of humans—and the only
+ obligate pathogen within the genus <i>Bacillus</i>. This disease can be classified as a zoonosis,
+ causing infected animals to transmit the disease to humans. <i>B. anthracis</i> is a Gram-positive,
+ endospore-forming, rod-shaped bacterium, with a width of 1.0–1.2 µm and a length of 3–5&#160;µm.
+ It can be grown in an ordinary nutrient medium under aerobic or anaerobic conditions.</p>
+ <p>It is one of few bacteria known to synthesize a protein capsule (poly-D-gamma-glutamic acid).
+ Like <i>Bordetella pertussis</i>, it forms a calmodulin-dependent adenylate cyclase exotoxin known
+ as anthrax edema factor, along with anthrax lethal factor. It bears close genotypic and phenotypic
+ resemblance to <i>Bacillus cereus</i> and <i>Bacillus thuringiensis</i>. All three species share
+ cellular dimensions and morphology</p>...'
+```
+```python
+>>> t3 = taxoniq.Taxon(accession_id="NC_000913.3")
+>>> t3.scientific_name
+'Escherichia coli str. K-12 substr. MG1655"'
+>>> t3.parent.parent.common_name
+'E. coli'
+>>> t3.refseq_representative_genome_accessions[0].length
+4641652
+# The get_from_s3() method is the only command that will trigger a network call.
+>>> seq = t3.refseq_representative_genome_accessions[0].get_from_s3().read()
+>>> len(seq)
+4641652
+>>> seq[:64]
+b'AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGAT'
+```
+## Retrieving sequences
+Mirrors of the NCBI BLAST databases are maintained on [AWS S3](https://registry.opendata.aws/ncbi-blast-databases/)
+(`s3://ncbi-blast-databases`) and Google Storage (`gs://blast-db`). This is a key resource, since S3 and GS have
+superior bandwidth and throughput compared to the NCBI FTP server, so range requests can be used to retrieve individual
+sequences from the database files without downloading and keeping a copy of the whole database.
+The Taxoniq PyPI distribution (the package you install using `pip3 install taxoniq`) indexes sequence accession IDs for
+the following NCBI BLAST databases:
+- Refseq viruses representative genomes (`ref_viruses_rep_genomes`) (nucleotide)
+- Refseq prokaryote representative genomes (contains refseq assembly) (`ref_prok_rep_genomes`) (nucleotide)
+- RefSeq Eukaryotic Representative Genome Database (`ref_euk_rep_genomes`) (nucleotide)
+- Betacoronavirus (nucleotide)
+Given an accession ID, Taxoniq can issue a single HTTP request and return a file-like object streaming the nucleotide
+sequence from the S3 or GS mirror as follows:
+```python
+with taxoniq.Accession("NC_000913.3").get_from_s3() as fh:
+    fh.read()
+```
+For brevity, you can use [urllib3.response.HTTPResponse.stream](https://urllib3.readthedocs.io/en/latest/advanced-usage.html)
+instead of `read(...)` to avoid holding the entire sequence in memory:
+```python
+with taxoniq.Accession("NC_000913.3").get_from_s3() as fh:
+    for chunk in fh.stream():
+        sys.stdout.buffer.write(chunk)
+```
+To retrieve many sequences quickly, you may want to use a threadpool to open multiple network connections at once:
+```python
+from concurrent.futures import ThreadPoolExecutor
+def fetch_seq(accession):
+    seq = accession.get_from_s3().read()
+    return (accession, seq)
+taxon = taxoniq.Taxon(scientific_name="Apis mellifera")
+for accession, seq in ThreadPoolExecutor().map(fetch_seq, taxon.refseq_representative_genome_accessions):
+    print(accession, len(seq))
+```
+This operation is also available in the CLI, as described below.
+## Command-line interface
+`pip3 install taxoniq` installs a command-line utility, `taxoniq`, which can be used to perform many of the same
+functions provided by the Python API:
+```
+>taxoniq child-nodes --taxon-id 2 --output-format '{tax_id}: {scientific_name}'
+[
+    "1224: Proteobacteria",
+    "2323: Bacteria incertae sedis",
+    "32066: Fusobacteria",
+    "40117: Nitrospirae",
+    "48479: environmental samples",
+    "49928: unclassified Bacteria",
+    "57723: Acidobacteria",
+    "68297: Dictyoglomi",
+    "74152: Elusimicrobia",
+    "200783: Aquificae",
+    "200918: Thermotogae",
+    "200930: Deferribacteres",
+    "200938: Chrysiogenetes",
+    "200940: Thermodesulfobacteria",
+    "203691: Spirochaetes",
+    "508458: Synergistetes",
+    "1783257: PVC group",
+    "1783270: FCB group",
+    "1783272: Terrabacteria group",
+    "1802340: Nitrospinae/Tectomicrobia group",
+    "1930617: Calditrichaeota",
+    "2138240: Coprothermobacterota",
+    "2498710: Caldiserica/Cryosericota group",
+    "2698788: Candidatus Krumholzibacteriota",
+    "2716431: Coleospermum",
+    "2780997: Vogosella"
+]
+```
+See `taxoniq --help` for full details.
+#### Retrieving sequences using the CLI
+To retrieve an individual sequence in FASTA format given an accession ID, use `taxoniq get-from-s3 --accession-id ACCESSION_ID`.
+To retrieve multiple sequences in FASTA format, use `--accession-id -` and pass the IDs on standard input, one per line:
+`taxoniq refseq-representative-genome-accessions --scientific-name="Apis mellifera" | jq -r .[] | taxoniq get-from-s3 --accession-id -`.
+## Using the nr/nt databases
+Because of their size, taxoniq wheels with indexes of the NT (GenBank Non-redundant nucleotide) BLAST database are
+distributed on GitHub instead of PyPI. After running `pip3 install taxoniq`, you can install the NT indexes as follows:
+- Navigate to https://github.com/chanzuckerberg/taxoniq/releases/latest
+- In the "Assets" section, for each link that starts with "ncbi_genbank" and ends with ".whl":
+  - Right-click on the asset link, and click "Copy link address"
+  - Run `pip3 install --upgrade <PASTED LINK ADDRESS>`
+The NT index packages also contain indexes for the RefSeq representative genomes and Betacoronavirus accessions (meaning
+they are are superset of the PyPI packages).
+## Streaming CLI I/O
+The `taxoniq` command-line interface can take streaming input from stdin and produce streaming output on stdout. This
+allows the amortization of startup and index load time and efficient operation as part of shell pipelines.
+The following
+example shows the pipelined operation of [fastp](https://github.com/OpenGene/fastp),
+[kraken2](https://github.com/DerrickWood/kraken2/wiki), and taxoniq to annotate hits found in a Betacoronavirus sample:
+```
+in progress
+```
+<!--
+fastp --thread $KRAKEN2_NUM_THREADS --low_complexity_filter -i R1.fastq.gz -I R2.fastq.gz -o filtered.R1.fastq.gz -O filtered.R2.fastq.gz
+kraken2 --paired nohuman_1.fastq nohuman_2.fastq --classified-out 'classified#.fastq' | taxoniq
+-->
+## Cookbook
+In progress
+## Links
+* [Project home page (GitHub)](https://github.com/chanzuckerberg/taxoniq)
+* [Documentation](https://chanzuckerberg.github.io/taxoniq/)
+* [Package distribution (PyPI)](https://pypi.python.org/pypi/taxoniq)
+* [Change log](https://github.com/chanzuckerberg/taxoniq/blob/master/Changes.rst)
+* [ETE Toolkit](http://etetoolkit.org/) and the [ETE Tutorial](http://etetoolkit.org/docs/latest/tutorial/index.html) - a general purpose
+  phylogenetic tree toolkit with a rich Python interface
+## License
+Taxoniq software is licensed under the terms of the [MIT License](LICENSE).
+Distributions of this package contain data from
+[NCBI Taxonomy, NCBI GenBank, and NCBI RefSeq](https://www.ncbi.nlm.nih.gov/) (Bethesda (MD): National Library of
+Medicine (US), National Center for Biotechnology Information). These data are released into the public domain under the
+[NCBI Public Domain Notice](LICENSE.NCBI).
+Distributions of this package contain text excerpts from Wikipedia licensed under the terms of the
+[CC-BY-SA License](LICENSE.WIKIPEDIA).
+## Bugs
+Please report bugs, issues, feature requests, etc. on [GitHub](https://github.com/chanzuckerberg/taxoniq/issues).
+
+%prep
+%autosetup -n taxoniq-0.6.0
+
+%build
+%py3_build
+
+%install
+%py3_install
+install -d -m755 %{buildroot}/%{_pkgdocdir}
+if [ -d doc ]; then cp -arf doc %{buildroot}/%{_pkgdocdir}; fi
+if [ -d docs ]; then cp -arf docs %{buildroot}/%{_pkgdocdir}; fi
+if [ -d example ]; then cp -arf example %{buildroot}/%{_pkgdocdir}; fi
+if [ -d examples ]; then cp -arf examples %{buildroot}/%{_pkgdocdir}; fi
+pushd %{buildroot}
+if [ -d usr/lib ]; then
+	find usr/lib -type f -printf "/%h/%f\n" >> filelist.lst
+fi
+if [ -d usr/lib64 ]; then
+	find usr/lib64 -type f -printf "/%h/%f\n" >> filelist.lst
+fi
+if [ -d usr/bin ]; then
+	find usr/bin -type f -printf "/%h/%f\n" >> filelist.lst
+fi
+if [ -d usr/sbin ]; then
+	find usr/sbin -type f -printf "/%h/%f\n" >> filelist.lst
+fi
+touch doclist.lst
+if [ -d usr/share/man ]; then
+	find usr/share/man -type f -printf "/%h/%f.gz\n" >> doclist.lst
+fi
+popd
+mv %{buildroot}/filelist.lst .
+mv %{buildroot}/doclist.lst .
+
+%files -n python3-taxoniq -f filelist.lst
+%dir %{python3_sitelib}/*
+
+%files help -f doclist.lst
+%{_docdir}/*
+
+%changelog
+* Fri May 05 2023 Python_Bot <Python_Bot@openeuler.org> - 0.6.0-1
+- Package Spec generated
diff --git a/sources b/sources
new file mode 100644
index 0000000..c9cba09
--- /dev/null
+++ b/sources
@@ -0,0 +1 @@
+b73804d36a50b0ab1e447038e5ec3dc1  taxoniq-0.6.0.tar.gz